FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626742_at:

>probe:Drosophila_2:1626742_at:195:491; Interrogation_Position=1401; Antisense; GTAAATCCGCGTCCAATTCAATAGT
>probe:Drosophila_2:1626742_at:43:85; Interrogation_Position=1423; Antisense; AGTGACCCGGATTATCATTGTGATC
>probe:Drosophila_2:1626742_at:206:149; Interrogation_Position=1467; Antisense; ACTTTGTGCTGGTGCTTGGCCTAAA
>probe:Drosophila_2:1626742_at:719:169; Interrogation_Position=1489; Antisense; AAAGGTGTGGTACCGCTATCGTCGT
>probe:Drosophila_2:1626742_at:707:339; Interrogation_Position=1503; Antisense; GCTATCGTCGTCACCTGGGCAAGGT
>probe:Drosophila_2:1626742_at:622:229; Interrogation_Position=1550; Antisense; AATGGGCCCACCGATGGTCAGGAGC
>probe:Drosophila_2:1626742_at:199:497; Interrogation_Position=1566; Antisense; GTCAGGAGCACGACCATCACGAAAA
>probe:Drosophila_2:1626742_at:74:549; Interrogation_Position=1606; Antisense; GGAGGCCAACTCCAGCAAGAATCTG
>probe:Drosophila_2:1626742_at:362:619; Interrogation_Position=1710; Antisense; TGCGCCTGTGGAGTAACCTTTCAGC
>probe:Drosophila_2:1626742_at:559:257; Interrogation_Position=1735; Antisense; CACTTTCCATGATCTCGCTAAACAT
>probe:Drosophila_2:1626742_at:576:653; Interrogation_Position=1753; Antisense; TAAACATGCCCCTCGAAAGTTACTC
>probe:Drosophila_2:1626742_at:13:393; Interrogation_Position=1767; Antisense; GAAAGTTACTCCGTTCTGTTGTTGA
>probe:Drosophila_2:1626742_at:174:517; Interrogation_Position=1891; Antisense; GTGTGTCTCTGTGTATATATCCCAT
>probe:Drosophila_2:1626742_at:505:277; Interrogation_Position=1954; Antisense; CTCATAGAGCCCCATTTTATAGCGC

Paste this into a BLAST search page for me
GTAAATCCGCGTCCAATTCAATAGTAGTGACCCGGATTATCATTGTGATCACTTTGTGCTGGTGCTTGGCCTAAAAAAGGTGTGGTACCGCTATCGTCGTGCTATCGTCGTCACCTGGGCAAGGTAATGGGCCCACCGATGGTCAGGAGCGTCAGGAGCACGACCATCACGAAAAGGAGGCCAACTCCAGCAAGAATCTGTGCGCCTGTGGAGTAACCTTTCAGCCACTTTCCATGATCTCGCTAAACATTAAACATGCCCCTCGAAAGTTACTCGAAAGTTACTCCGTTCTGTTGTTGAGTGTGTCTCTGTGTATATATCCCATCTCATAGAGCCCCATTTTATAGCGC

Full Affymetrix probeset data:

Annotations for 1626742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720