FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626743_at:

>probe:Drosophila_2:1626743_at:653:279; Interrogation_Position=105; Antisense; CTCCATTCCCGTGGTGGCCAAGGTG
>probe:Drosophila_2:1626743_at:133:147; Interrogation_Position=140; Antisense; ACTACGATGCCGTGGGAACCACCCA
>probe:Drosophila_2:1626743_at:691:303; Interrogation_Position=149; Antisense; CCGTGGGAACCACCCAGCAGAATGT
>probe:Drosophila_2:1626743_at:728:113; Interrogation_Position=164; Antisense; AGCAGAATGTGGTGCGCTCCTTCGG
>probe:Drosophila_2:1626743_at:199:597; Interrogation_Position=195; Antisense; TGTGTCCACCTACTCCAAGAACGTG
>probe:Drosophila_2:1626743_at:468:585; Interrogation_Position=218; Antisense; TGGTTACCCCGTACTCCAGTGTCAG
>probe:Drosophila_2:1626743_at:263:85; Interrogation_Position=235; Antisense; AGTGTCAGCAAGGTGGACTCCCGCA
>probe:Drosophila_2:1626743_at:308:587; Interrogation_Position=248; Antisense; TGGACTCCCGCATCACCAACAATGT
>probe:Drosophila_2:1626743_at:183:127; Interrogation_Position=262; Antisense; ACCAACAATGTCTACACTCCCAAGA
>probe:Drosophila_2:1626743_at:227:283; Interrogation_Position=302; Antisense; CTGCTCCAGTGATCACCAAGTCCTT
>probe:Drosophila_2:1626743_at:681:513; Interrogation_Position=310; Antisense; GTGATCACCAAGTCCTTCTACGCTG
>probe:Drosophila_2:1626743_at:667:617; Interrogation_Position=342; Antisense; TGCTCCCGTCGTGGCTAAGACCGTG
>probe:Drosophila_2:1626743_at:27:319; Interrogation_Position=592; Antisense; GCCGCCTATGTGAAGTACTCGCCCG
>probe:Drosophila_2:1626743_at:41:723; Interrogation_Position=626; Antisense; TTGCCCACGCCAGCTTCGATGGATT

Paste this into a BLAST search page for me
CTCCATTCCCGTGGTGGCCAAGGTGACTACGATGCCGTGGGAACCACCCACCGTGGGAACCACCCAGCAGAATGTAGCAGAATGTGGTGCGCTCCTTCGGTGTGTCCACCTACTCCAAGAACGTGTGGTTACCCCGTACTCCAGTGTCAGAGTGTCAGCAAGGTGGACTCCCGCATGGACTCCCGCATCACCAACAATGTACCAACAATGTCTACACTCCCAAGACTGCTCCAGTGATCACCAAGTCCTTGTGATCACCAAGTCCTTCTACGCTGTGCTCCCGTCGTGGCTAAGACCGTGGCCGCCTATGTGAAGTACTCGCCCGTTGCCCACGCCAGCTTCGATGGATT

Full Affymetrix probeset data:

Annotations for 1626743_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720