FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626745_at:

>probe:Drosophila_2:1626745_at:490:333; Interrogation_Position=1022; Antisense; GCTGCTTGGTTAATGGTGCCGGCCT
>probe:Drosophila_2:1626745_at:287:207; Interrogation_Position=1072; Antisense; AAGCTGAATGGAGGCGAGCCCGCCA
>probe:Drosophila_2:1626745_at:153:401; Interrogation_Position=1087; Antisense; GAGCCCGCCAACTTTTTGGACGTCG
>probe:Drosophila_2:1626745_at:715:453; Interrogation_Position=1129; Antisense; GATCAGGTGGCCAAAGCCTTCGAGA
>probe:Drosophila_2:1626745_at:683:95; Interrogation_Position=1151; Antisense; AGATCCTCACTGCTGACCCGAAAGT
>probe:Drosophila_2:1626745_at:628:227; Interrogation_Position=1182; Antisense; AATCCTGGTCAATGTCTTTGGCGGC
>probe:Drosophila_2:1626745_at:560:5; Interrogation_Position=1207; Antisense; ATTGTCAATTGTGCCACCATTGCCA
>probe:Drosophila_2:1626745_at:368:251; Interrogation_Position=1230; Antisense; CAATGGCATTGTGGCTGCATCCAAA
>probe:Drosophila_2:1626745_at:648:367; Interrogation_Position=1266; Antisense; GAATGTTCCACTGGTTGTGCGACTG
>probe:Drosophila_2:1626745_at:98:97; Interrogation_Position=1319; Antisense; AGATCCTGAAGAATTCGGGCCTGCC
>probe:Drosophila_2:1626745_at:715:83; Interrogation_Position=1357; Antisense; AGTGACTTGGATGATGCCGCCCACA
>probe:Drosophila_2:1626745_at:152:435; Interrogation_Position=1415; Antisense; GAGGAGAGCATGTCTTCCAGAATGA
>probe:Drosophila_2:1626745_at:614:133; Interrogation_Position=1444; Antisense; ACGCTCATTAGCATTTACAACGGTT
>probe:Drosophila_2:1626745_at:623:107; Interrogation_Position=1550; Antisense; AGAAGTACCTTAGCCATCTATCAAA

Paste this into a BLAST search page for me
GCTGCTTGGTTAATGGTGCCGGCCTAAGCTGAATGGAGGCGAGCCCGCCAGAGCCCGCCAACTTTTTGGACGTCGGATCAGGTGGCCAAAGCCTTCGAGAAGATCCTCACTGCTGACCCGAAAGTAATCCTGGTCAATGTCTTTGGCGGCATTGTCAATTGTGCCACCATTGCCACAATGGCATTGTGGCTGCATCCAAAGAATGTTCCACTGGTTGTGCGACTGAGATCCTGAAGAATTCGGGCCTGCCAGTGACTTGGATGATGCCGCCCACAGAGGAGAGCATGTCTTCCAGAATGAACGCTCATTAGCATTTACAACGGTTAGAAGTACCTTAGCCATCTATCAAA

Full Affymetrix probeset data:

Annotations for 1626745_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720