FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626746_at:

>probe:Drosophila_2:1626746_at:213:179; Interrogation_Position=302; Antisense; AAACAATATATGCTTTTCGAGAATC
>probe:Drosophila_2:1626746_at:497:341; Interrogation_Position=313; Antisense; GCTTTTCGAGAATCATTTCCACCAG
>probe:Drosophila_2:1626746_at:259:673; Interrogation_Position=339; Antisense; TAGCCAACCGGATGAGGTGCCTCAA
>probe:Drosophila_2:1626746_at:707:57; Interrogation_Position=350; Antisense; ATGAGGTGCCTCAAAGCCGTCTTAA
>probe:Drosophila_2:1626746_at:158:175; Interrogation_Position=362; Antisense; AAAGCCGTCTTAACACCTGGCTGAC
>probe:Drosophila_2:1626746_at:621:497; Interrogation_Position=368; Antisense; GTCTTAACACCTGGCTGACCAACTG
>probe:Drosophila_2:1626746_at:421:195; Interrogation_Position=388; Antisense; AACTGCACCTCGACATCATCAGTGG
>probe:Drosophila_2:1626746_at:491:129; Interrogation_Position=394; Antisense; ACCTCGACATCATCAGTGGATCCTG
>probe:Drosophila_2:1626746_at:330:519; Interrogation_Position=409; Antisense; GTGGATCCTGTGAAGCGAATTATTT
>probe:Drosophila_2:1626746_at:567:701; Interrogation_Position=431; Antisense; TTTTAATAAATCTCTGCCAATCGGT
>probe:Drosophila_2:1626746_at:417:165; Interrogation_Position=438; Antisense; AAATCTCTGCCAATCGGTGCGACTG
>probe:Drosophila_2:1626746_at:723:39; Interrogation_Position=450; Antisense; ATCGGTGCGACTGACAACGGAGCAT
>probe:Drosophila_2:1626746_at:249:403; Interrogation_Position=458; Antisense; GACTGACAACGGAGCATGTGGATTT
>probe:Drosophila_2:1626746_at:518:289; Interrogation_Position=467; Antisense; CGGAGCATGTGGATTTGATTGTTAA

Paste this into a BLAST search page for me
AAACAATATATGCTTTTCGAGAATCGCTTTTCGAGAATCATTTCCACCAGTAGCCAACCGGATGAGGTGCCTCAAATGAGGTGCCTCAAAGCCGTCTTAAAAAGCCGTCTTAACACCTGGCTGACGTCTTAACACCTGGCTGACCAACTGAACTGCACCTCGACATCATCAGTGGACCTCGACATCATCAGTGGATCCTGGTGGATCCTGTGAAGCGAATTATTTTTTTAATAAATCTCTGCCAATCGGTAAATCTCTGCCAATCGGTGCGACTGATCGGTGCGACTGACAACGGAGCATGACTGACAACGGAGCATGTGGATTTCGGAGCATGTGGATTTGATTGTTAA

Full Affymetrix probeset data:

Annotations for 1626746_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720