FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626748_at:

>probe:Drosophila_2:1626748_at:305:605; Interrogation_Position=1094; Antisense; TGATTATGCTCAGCATGCTCGTCGT
>probe:Drosophila_2:1626748_at:95:53; Interrogation_Position=1108; Antisense; ATGCTCGTCGTTGTCATGGCTCTGA
>probe:Drosophila_2:1626748_at:311:229; Interrogation_Position=1141; Antisense; AATGGAGTTTATGCCGCTCAGCGCG
>probe:Drosophila_2:1626748_at:607:321; Interrogation_Position=1161; Antisense; GCGCGACTCCTACAACTCAAAGGAT
>probe:Drosophila_2:1626748_at:690:231; Interrogation_Position=1201; Antisense; AATGCCCTGCCCAACGAAGGAGTGG
>probe:Drosophila_2:1626748_at:117:535; Interrogation_Position=1264; Antisense; GGTCCCACTGGTATCGACGGAAGCG
>probe:Drosophila_2:1626748_at:257:367; Interrogation_Position=1357; Antisense; GAATCCGCTGCGCTGACTACCGATG
>probe:Drosophila_2:1626748_at:640:719; Interrogation_Position=1495; Antisense; TTCCATCGCAACAGCATCGATCTGG
>probe:Drosophila_2:1626748_at:32:287; Interrogation_Position=1528; Antisense; CGCAATGCGGGTCCCTATTTCGACA
>probe:Drosophila_2:1626748_at:149:527; Interrogation_Position=1584; Antisense; GGGCAAGACGGCCTATTTGAACTGC
>probe:Drosophila_2:1626748_at:663:613; Interrogation_Position=1601; Antisense; TGAACTGCCGAGTCAAGAATCTGGG
>probe:Drosophila_2:1626748_at:158:41; Interrogation_Position=1619; Antisense; ATCTGGGCAATAAGACGCGCCATTG
>probe:Drosophila_2:1626748_at:128:135; Interrogation_Position=1633; Antisense; ACGCGCCATTGGTCATATGTTTGCC
>probe:Drosophila_2:1626748_at:593:627; Interrogation_Position=1654; Antisense; TGCCATCATTTGACAATTTGCCTTG

Paste this into a BLAST search page for me
TGATTATGCTCAGCATGCTCGTCGTATGCTCGTCGTTGTCATGGCTCTGAAATGGAGTTTATGCCGCTCAGCGCGGCGCGACTCCTACAACTCAAAGGATAATGCCCTGCCCAACGAAGGAGTGGGGTCCCACTGGTATCGACGGAAGCGGAATCCGCTGCGCTGACTACCGATGTTCCATCGCAACAGCATCGATCTGGCGCAATGCGGGTCCCTATTTCGACAGGGCAAGACGGCCTATTTGAACTGCTGAACTGCCGAGTCAAGAATCTGGGATCTGGGCAATAAGACGCGCCATTGACGCGCCATTGGTCATATGTTTGCCTGCCATCATTTGACAATTTGCCTTG

Full Affymetrix probeset data:

Annotations for 1626748_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720