FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626750_at:

>probe:Drosophila_2:1626750_at:510:313; Interrogation_Position=106; Antisense; GCCACCTCGAGTGAATGTCGGCATC
>probe:Drosophila_2:1626750_at:387:499; Interrogation_Position=122; Antisense; GTCGGCATCAATATCGGCGGACCAC
>probe:Drosophila_2:1626750_at:605:87; Interrogation_Position=13; Antisense; AGTCAGTAGTTAGCCATCGGTCGAG
>probe:Drosophila_2:1626750_at:508:25; Interrogation_Position=161; Antisense; ATAGGCGTGGGCATCGGCTTTGCTC
>probe:Drosophila_2:1626750_at:570:691; Interrogation_Position=179; Antisense; TTTGCTCCGCCACCCGTGGTGGTTG
>probe:Drosophila_2:1626750_at:226:93; Interrogation_Position=20; Antisense; AGTTAGCCATCGGTCGAGATGCCAC
>probe:Drosophila_2:1626750_at:596:311; Interrogation_Position=211; Antisense; GCCACCAACTGTGATCGTCGGAGCA
>probe:Drosophila_2:1626750_at:205:195; Interrogation_Position=217; Antisense; AACTGTGATCGTCGGAGCACCACCA
>probe:Drosophila_2:1626750_at:300:309; Interrogation_Position=295; Antisense; CCAGGCTCCGGTGGCCAGTGTGTAT
>probe:Drosophila_2:1626750_at:480:517; Interrogation_Position=312; Antisense; GTGTGTATGCCCAGCCGCAAGGAGA
>probe:Drosophila_2:1626750_at:372:625; Interrogation_Position=319; Antisense; TGCCCAGCCGCAAGGAGAGGTTTTC
>probe:Drosophila_2:1626750_at:129:75; Interrogation_Position=331; Antisense; AGGAGAGGTTTTCTGCTGCACTATT
>probe:Drosophila_2:1626750_at:221:541; Interrogation_Position=337; Antisense; GGTTTTCTGCTGCACTATTCTCTGA
>probe:Drosophila_2:1626750_at:614:267; Interrogation_Position=48; Antisense; CAGGACGCGGATACGGAGGACCACC

Paste this into a BLAST search page for me
GCCACCTCGAGTGAATGTCGGCATCGTCGGCATCAATATCGGCGGACCACAGTCAGTAGTTAGCCATCGGTCGAGATAGGCGTGGGCATCGGCTTTGCTCTTTGCTCCGCCACCCGTGGTGGTTGAGTTAGCCATCGGTCGAGATGCCACGCCACCAACTGTGATCGTCGGAGCAAACTGTGATCGTCGGAGCACCACCACCAGGCTCCGGTGGCCAGTGTGTATGTGTGTATGCCCAGCCGCAAGGAGATGCCCAGCCGCAAGGAGAGGTTTTCAGGAGAGGTTTTCTGCTGCACTATTGGTTTTCTGCTGCACTATTCTCTGACAGGACGCGGATACGGAGGACCACC

Full Affymetrix probeset data:

Annotations for 1626750_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720