FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626752_at:

>probe:Drosophila_2:1626752_at:89:427; Interrogation_Position=1002; Antisense; GAGAGTTCTCCTCCGTGGTGGAATA
>probe:Drosophila_2:1626752_at:505:531; Interrogation_Position=1018; Antisense; GGTGGAATACTTAGCGCATCGTCTT
>probe:Drosophila_2:1626752_at:357:675; Interrogation_Position=1029; Antisense; TAGCGCATCGTCTTGGTTTCAGCAC
>probe:Drosophila_2:1626752_at:612:649; Interrogation_Position=1047; Antisense; TCAGCACCAGTGAAGCCAAGGCAAT
>probe:Drosophila_2:1626752_at:234:67; Interrogation_Position=1073; Antisense; ATGGACAAACATCCGCAGGTGCACA
>probe:Drosophila_2:1626752_at:578:615; Interrogation_Position=1092; Antisense; TGCACACCGTGCGAGTTACCAAGAT
>probe:Drosophila_2:1626752_at:2:535; Interrogation_Position=1123; Antisense; GGTGCTAGACTACCTACTCGATGAG
>probe:Drosophila_2:1626752_at:76:607; Interrogation_Position=1144; Antisense; TGAGGCCCAGTTTACCAGATTTGAG
>probe:Drosophila_2:1626752_at:562:165; Interrogation_Position=1177; Antisense; AAATCCTCGAATTCTATGCCACAGC
>probe:Drosophila_2:1626752_at:210:191; Interrogation_Position=1230; Antisense; AACTGAAATCGCACGGTTGTCGACC
>probe:Drosophila_2:1626752_at:602:727; Interrogation_Position=1263; Antisense; TTGTAATTCTTTGCCGCAGCCGGAG
>probe:Drosophila_2:1626752_at:206:611; Interrogation_Position=1363; Antisense; TGACGAATGACCTGATGCCATCACC
>probe:Drosophila_2:1626752_at:558:215; Interrogation_Position=917; Antisense; AAGATCATGCCGTGGATGGTGCGCT
>probe:Drosophila_2:1626752_at:53:615; Interrogation_Position=969; Antisense; TGAAGCTTTCTCTCGACGAACTGAA

Paste this into a BLAST search page for me
GAGAGTTCTCCTCCGTGGTGGAATAGGTGGAATACTTAGCGCATCGTCTTTAGCGCATCGTCTTGGTTTCAGCACTCAGCACCAGTGAAGCCAAGGCAATATGGACAAACATCCGCAGGTGCACATGCACACCGTGCGAGTTACCAAGATGGTGCTAGACTACCTACTCGATGAGTGAGGCCCAGTTTACCAGATTTGAGAAATCCTCGAATTCTATGCCACAGCAACTGAAATCGCACGGTTGTCGACCTTGTAATTCTTTGCCGCAGCCGGAGTGACGAATGACCTGATGCCATCACCAAGATCATGCCGTGGATGGTGCGCTTGAAGCTTTCTCTCGACGAACTGAA

Full Affymetrix probeset data:

Annotations for 1626752_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720