FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626753_at:

>probe:Drosophila_2:1626753_at:505:119; Interrogation_Position=422; Antisense; AGCTGCGCTTGAGGTTCGATTGTCC
>probe:Drosophila_2:1626753_at:595:197; Interrogation_Position=454; Antisense; AACGAGGTGAGGTTCCAGCTATTCC
>probe:Drosophila_2:1626753_at:458:117; Interrogation_Position=470; Antisense; AGCTATTCCCCAAGATCTGCAAGGC
>probe:Drosophila_2:1626753_at:254:451; Interrogation_Position=496; Antisense; GATCGAGACTGTGCCGTGTGGCAAC
>probe:Drosophila_2:1626753_at:560:421; Interrogation_Position=548; Antisense; GAGCAAGCAGCTGTGTCTCTGGCGT
>probe:Drosophila_2:1626753_at:308:175; Interrogation_Position=576; Antisense; AAAGCCGCTAGAGGAGACTCCACAT
>probe:Drosophila_2:1626753_at:383:3; Interrogation_Position=607; Antisense; ATTCTGGGCTTGATACCTCGCAAGT
>probe:Drosophila_2:1626753_at:576:397; Interrogation_Position=685; Antisense; GACATGGACTGCTGGCCAAGGGTCT
>probe:Drosophila_2:1626753_at:229:629; Interrogation_Position=768; Antisense; TCCAGTGCCAGTGAAGCGATCCTTC
>probe:Drosophila_2:1626753_at:439:327; Interrogation_Position=783; Antisense; GCGATCCTTCGACTATCTTACAGAG
>probe:Drosophila_2:1626753_at:649:7; Interrogation_Position=878; Antisense; ATTGCTTTCCGAATGTGTGCTGCCA
>probe:Drosophila_2:1626753_at:311:211; Interrogation_Position=934; Antisense; AAGAAGTCCGTGCTCACACTGATGG
>probe:Drosophila_2:1626753_at:547:439; Interrogation_Position=954; Antisense; GATGGCCAACTTTCTCAACGTGGAC
>probe:Drosophila_2:1626753_at:9:557; Interrogation_Position=975; Antisense; GGACTTCGTGAAGCGACTGGCACAG

Paste this into a BLAST search page for me
AGCTGCGCTTGAGGTTCGATTGTCCAACGAGGTGAGGTTCCAGCTATTCCAGCTATTCCCCAAGATCTGCAAGGCGATCGAGACTGTGCCGTGTGGCAACGAGCAAGCAGCTGTGTCTCTGGCGTAAAGCCGCTAGAGGAGACTCCACATATTCTGGGCTTGATACCTCGCAAGTGACATGGACTGCTGGCCAAGGGTCTTCCAGTGCCAGTGAAGCGATCCTTCGCGATCCTTCGACTATCTTACAGAGATTGCTTTCCGAATGTGTGCTGCCAAAGAAGTCCGTGCTCACACTGATGGGATGGCCAACTTTCTCAACGTGGACGGACTTCGTGAAGCGACTGGCACAG

Full Affymetrix probeset data:

Annotations for 1626753_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720