FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626755_at:

>probe:Drosophila_2:1626755_at:34:225; Interrogation_Position=4022; Antisense; AAGGATTTCCTGGACCACGCTGTGC
>probe:Drosophila_2:1626755_at:490:135; Interrogation_Position=4038; Antisense; ACGCTGTGCGCGAGAATCTGTCGTC
>probe:Drosophila_2:1626755_at:160:613; Interrogation_Position=4080; Antisense; TGAACCCGACCTCTGTGCTGGAGTA
>probe:Drosophila_2:1626755_at:148:487; Interrogation_Position=4102; Antisense; GTACGTATGCGCCAAGTCCAAGATC
>probe:Drosophila_2:1626755_at:466:97; Interrogation_Position=4122; Antisense; AGATCAGCGCAAGTTGCCGCAACGG
>probe:Drosophila_2:1626755_at:194:287; Interrogation_Position=4151; Antisense; CTGGCCCAGGTACCCGAAATTCTGA
>probe:Drosophila_2:1626755_at:669:169; Interrogation_Position=4176; Antisense; AAAGCGGCCCACGTTCCGATTCTGA
>probe:Drosophila_2:1626755_at:641:579; Interrogation_Position=4206; Antisense; TGGCCTTCGTACAACAACTGATGGT
>probe:Drosophila_2:1626755_at:96:453; Interrogation_Position=4262; Antisense; GATCTCATTGACCTTCTGATGCGTA
>probe:Drosophila_2:1626755_at:662:143; Interrogation_Position=4316; Antisense; ACTCACATCTCCAAGGGCGTCGTAT
>probe:Drosophila_2:1626755_at:665:727; Interrogation_Position=4347; Antisense; TTGGAAGCCCTGACAACGTGGCCGA
>probe:Drosophila_2:1626755_at:33:319; Interrogation_Position=4379; Antisense; GCCGACTCCTCATCAAACTTATAGA
>probe:Drosophila_2:1626755_at:686:463; Interrogation_Position=4402; Antisense; GATTGGACCTGACTTGAAATTACGA
>probe:Drosophila_2:1626755_at:309:49; Interrogation_Position=4539; Antisense; ATGCCCGTTGGTGTATTATGTTTTG

Paste this into a BLAST search page for me
AAGGATTTCCTGGACCACGCTGTGCACGCTGTGCGCGAGAATCTGTCGTCTGAACCCGACCTCTGTGCTGGAGTAGTACGTATGCGCCAAGTCCAAGATCAGATCAGCGCAAGTTGCCGCAACGGCTGGCCCAGGTACCCGAAATTCTGAAAAGCGGCCCACGTTCCGATTCTGATGGCCTTCGTACAACAACTGATGGTGATCTCATTGACCTTCTGATGCGTAACTCACATCTCCAAGGGCGTCGTATTTGGAAGCCCTGACAACGTGGCCGAGCCGACTCCTCATCAAACTTATAGAGATTGGACCTGACTTGAAATTACGAATGCCCGTTGGTGTATTATGTTTTG

Full Affymetrix probeset data:

Annotations for 1626755_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720