FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626759_at:

>probe:Drosophila_2:1626759_at:42:163; Interrogation_Position=109; Antisense; ACAATTGATGCCGAAAGTGCCTCAA
>probe:Drosophila_2:1626759_at:8:395; Interrogation_Position=121; Antisense; GAAAGTGCCTCAATGGCACTGCCTG
>probe:Drosophila_2:1626759_at:233:145; Interrogation_Position=138; Antisense; ACTGCCTGCGCTACTTTAAGCATGA
>probe:Drosophila_2:1626759_at:654:339; Interrogation_Position=147; Antisense; GCTACTTTAAGCATGATGTCCTGAT
>probe:Drosophila_2:1626759_at:139:63; Interrogation_Position=162; Antisense; ATGTCCTGATGATGCGCCGCTGTCG
>probe:Drosophila_2:1626759_at:150:445; Interrogation_Position=169; Antisense; GATGATGCGCCGCTGTCGCCACTTG
>probe:Drosophila_2:1626759_at:605:665; Interrogation_Position=202; Antisense; TACAGCGCCACGACTGGGCGATGTC
>probe:Drosophila_2:1626759_at:217:137; Interrogation_Position=211; Antisense; ACGACTGGGCGATGTCCTCAAGCGA
>probe:Drosophila_2:1626759_at:109:695; Interrogation_Position=25; Antisense; TTTTTGGCTGTCGTTTCCCTACTGT
>probe:Drosophila_2:1626759_at:440:693; Interrogation_Position=38; Antisense; TTTCCCTACTGTGCCTTGCATTCTT
>probe:Drosophila_2:1626759_at:112:307; Interrogation_Position=51; Antisense; CCTTGCATTCTTCGCTTGGGCAAAA
>probe:Drosophila_2:1626759_at:349:635; Interrogation_Position=62; Antisense; TCGCTTGGGCAAAAGCTGGACCTGT
>probe:Drosophila_2:1626759_at:695:119; Interrogation_Position=75; Antisense; AGCTGGACCTGTGCCAATTGTGAAT
>probe:Drosophila_2:1626759_at:626:593; Interrogation_Position=93; Antisense; TGTGAATGAGGCACCAACAATTGAT

Paste this into a BLAST search page for me
ACAATTGATGCCGAAAGTGCCTCAAGAAAGTGCCTCAATGGCACTGCCTGACTGCCTGCGCTACTTTAAGCATGAGCTACTTTAAGCATGATGTCCTGATATGTCCTGATGATGCGCCGCTGTCGGATGATGCGCCGCTGTCGCCACTTGTACAGCGCCACGACTGGGCGATGTCACGACTGGGCGATGTCCTCAAGCGATTTTTGGCTGTCGTTTCCCTACTGTTTTCCCTACTGTGCCTTGCATTCTTCCTTGCATTCTTCGCTTGGGCAAAATCGCTTGGGCAAAAGCTGGACCTGTAGCTGGACCTGTGCCAATTGTGAATTGTGAATGAGGCACCAACAATTGAT

Full Affymetrix probeset data:

Annotations for 1626759_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720