FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626760_at:

>probe:Drosophila_2:1626760_at:694:185; Interrogation_Position=1039; Antisense; AACAGCGACTATTTTGATTTCCAGA
>probe:Drosophila_2:1626760_at:140:389; Interrogation_Position=1197; Antisense; GAAAAACTCCATACCTTACATACAA
>probe:Drosophila_2:1626760_at:258:51; Interrogation_Position=630; Antisense; ATGCGCTCTTCGGATTCAGCTTCAA
>probe:Drosophila_2:1626760_at:379:599; Interrogation_Position=676; Antisense; TGTCGCCGTCGTGGAACTAATGCAG
>probe:Drosophila_2:1626760_at:678:177; Interrogation_Position=707; Antisense; AAACTGCCAATTGCCAGCGTGGACA
>probe:Drosophila_2:1626760_at:725:143; Interrogation_Position=767; Antisense; ACTGAATGCGACGTGGAGCCGGCTC
>probe:Drosophila_2:1626760_at:712:385; Interrogation_Position=842; Antisense; GAACATCACTACTTGGGCGGCAGAT
>probe:Drosophila_2:1626760_at:444:321; Interrogation_Position=878; Antisense; GCCCTGCAGCGCAAATACGAACTGA
>probe:Drosophila_2:1626760_at:596:669; Interrogation_Position=893; Antisense; TACGAACTGAATCTGCCCGTTTATC
>probe:Drosophila_2:1626760_at:310:47; Interrogation_Position=915; Antisense; ATCCGGGCAACGAGCTGTGCGTCAA
>probe:Drosophila_2:1626760_at:216:329; Interrogation_Position=933; Antisense; GCGTCAAGCTGTGATTTCTGCATTT
>probe:Drosophila_2:1626760_at:623:715; Interrogation_Position=948; Antisense; TTCTGCATTTATGCGGTTTCCCAAT
>probe:Drosophila_2:1626760_at:477:441; Interrogation_Position=977; Antisense; GATGGAGTCTTGAGCCGCAACGTCT
>probe:Drosophila_2:1626760_at:451:499; Interrogation_Position=998; Antisense; GTCTGGTTTCCATCCATCATTTGAA

Paste this into a BLAST search page for me
AACAGCGACTATTTTGATTTCCAGAGAAAAACTCCATACCTTACATACAAATGCGCTCTTCGGATTCAGCTTCAATGTCGCCGTCGTGGAACTAATGCAGAAACTGCCAATTGCCAGCGTGGACAACTGAATGCGACGTGGAGCCGGCTCGAACATCACTACTTGGGCGGCAGATGCCCTGCAGCGCAAATACGAACTGATACGAACTGAATCTGCCCGTTTATCATCCGGGCAACGAGCTGTGCGTCAAGCGTCAAGCTGTGATTTCTGCATTTTTCTGCATTTATGCGGTTTCCCAATGATGGAGTCTTGAGCCGCAACGTCTGTCTGGTTTCCATCCATCATTTGAA

Full Affymetrix probeset data:

Annotations for 1626760_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720