Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626762_s_at:

>probe:Drosophila_2:1626762_s_at:283:307; Interrogation_Position=134; Antisense; CCTGCCAGAGTCTTCGCAAATCATT
>probe:Drosophila_2:1626762_s_at:55:165; Interrogation_Position=151; Antisense; AAATCATTTGAGCAATCCTGCCCTG
>probe:Drosophila_2:1626762_s_at:426:91; Interrogation_Position=16; Antisense; AGTTTTCCAGACAAGGCGGAGCGCA
>probe:Drosophila_2:1626762_s_at:354:235; Interrogation_Position=164; Antisense; AATCCTGCCCTGGTCAATGGGTAAA
>probe:Drosophila_2:1626762_s_at:673:529; Interrogation_Position=182; Antisense; GGGTAAAGCACTTCGACCGCAAGCG
>probe:Drosophila_2:1626762_s_at:181:413; Interrogation_Position=196; Antisense; GACCGCAAGCGTACTTATGACCAGT
>probe:Drosophila_2:1626762_s_at:493:357; Interrogation_Position=200; Antisense; GCAAGCGTACTTATGACCAGTTTAA
>probe:Drosophila_2:1626762_s_at:171:169; Interrogation_Position=230; Antisense; AAATGGCCCAGGGTTATGATCCCTT
>probe:Drosophila_2:1626762_s_at:13:267; Interrogation_Position=238; Antisense; CAGGGTTATGATCCCTTGGAGGACC
>probe:Drosophila_2:1626762_s_at:632:219; Interrogation_Position=43; Antisense; AAGTGCTGGAACAACCGGGACGAGT
>probe:Drosophila_2:1626762_s_at:257:203; Interrogation_Position=54; Antisense; CAACCGGGACGAGTATTGGAAATGT
>probe:Drosophila_2:1626762_s_at:59:561; Interrogation_Position=71; Antisense; GGAAATGTCTCGAGGAGCACGCCCC
>probe:Drosophila_2:1626762_s_at:459:75; Interrogation_Position=83; Antisense; AGGAGCACGCCCCAAAGCACAGTTC
>probe:Drosophila_2:1626762_s_at:135:321; Interrogation_Position=91; Antisense; GCCCCAAAGCACAGTTCTACCAGTG

Paste this into a BLAST search page for me
CCTGCCAGAGTCTTCGCAAATCATTAAATCATTTGAGCAATCCTGCCCTGAGTTTTCCAGACAAGGCGGAGCGCAAATCCTGCCCTGGTCAATGGGTAAAGGGTAAAGCACTTCGACCGCAAGCGGACCGCAAGCGTACTTATGACCAGTGCAAGCGTACTTATGACCAGTTTAAAAATGGCCCAGGGTTATGATCCCTTCAGGGTTATGATCCCTTGGAGGACCAAGTGCTGGAACAACCGGGACGAGTCAACCGGGACGAGTATTGGAAATGTGGAAATGTCTCGAGGAGCACGCCCCAGGAGCACGCCCCAAAGCACAGTTCGCCCCAAAGCACAGTTCTACCAGTG

Full Affymetrix probeset data:

Annotations for 1626762_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime