Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626763_a_at:

>probe:Drosophila_2:1626763_a_at:84:267; Interrogation_Position=369; Antisense; GAGTCGTCGAGCTCCCGAAAACGGA
>probe:Drosophila_2:1626763_a_at:27:77; Interrogation_Position=426; Antisense; AGGAGCAAAACTCGCCCATCTATAT
>probe:Drosophila_2:1626763_a_at:336:31; Interrogation_Position=458; Antisense; ATAATACCTGGAGGCGTGGCTGACA
>probe:Drosophila_2:1626763_a_at:290:333; Interrogation_Position=476; Antisense; GCTGACAGGCATGGTGGTCTGAAAA
>probe:Drosophila_2:1626763_a_at:549:427; Interrogation_Position=504; Antisense; GAGATCAACTTTTGTCTGTGAATGG
>probe:Drosophila_2:1626763_a_at:507:175; Interrogation_Position=547; Antisense; AAACCACGAGAAGGCCGTAGAGCTA
>probe:Drosophila_2:1626763_a_at:679:285; Interrogation_Position=582; Antisense; CTGTCGGATCTGTAAAGCTGGTGGT
>probe:Drosophila_2:1626763_a_at:586:491; Interrogation_Position=593; Antisense; GTAAAGCTGGTGGTACGCTACACAC
>probe:Drosophila_2:1626763_a_at:373:487; Interrogation_Position=605; Antisense; GTACGCTACACACCAAAGGTTCTCG
>probe:Drosophila_2:1626763_a_at:27:33; Interrogation_Position=651; Antisense; ATAAGCAACGCAACACACGTCGTCG
>probe:Drosophila_2:1626763_a_at:236:157; Interrogation_Position=665; Antisense; ACACGTCGTCGCCAATAAGGCACAT
>probe:Drosophila_2:1626763_a_at:598:727; Interrogation_Position=700; Antisense; TTGTGCCATAGTAGTTTTTGCCATT
>probe:Drosophila_2:1626763_a_at:251:477; Interrogation_Position=713; Antisense; GTTTTTGCCATTAGACCATGCTGAT
>probe:Drosophila_2:1626763_a_at:574:455; Interrogation_Position=735; Antisense; GATATGCACGTATCAAGCCCTTTAC

Paste this into a BLAST search page for me
GAGTCGTCGAGCTCCCGAAAACGGAAGGAGCAAAACTCGCCCATCTATATATAATACCTGGAGGCGTGGCTGACAGCTGACAGGCATGGTGGTCTGAAAAGAGATCAACTTTTGTCTGTGAATGGAAACCACGAGAAGGCCGTAGAGCTACTGTCGGATCTGTAAAGCTGGTGGTGTAAAGCTGGTGGTACGCTACACACGTACGCTACACACCAAAGGTTCTCGATAAGCAACGCAACACACGTCGTCGACACGTCGTCGCCAATAAGGCACATTTGTGCCATAGTAGTTTTTGCCATTGTTTTTGCCATTAGACCATGCTGATGATATGCACGTATCAAGCCCTTTAC

Full Affymetrix probeset data:

Annotations for 1626763_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime