FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626764_at:

>probe:Drosophila_2:1626764_at:596:729; Interrogation_Position=1535; Antisense; TTGGCTACAGTCTGCACTTGAACAG
>probe:Drosophila_2:1626764_at:568:97; Interrogation_Position=1674; Antisense; AGATCTGTCCACCTTTGCGGAGGCT
>probe:Drosophila_2:1626764_at:511:67; Interrogation_Position=1732; Antisense; ATGGCCCTCTGCTGGGTGATCTTCG
>probe:Drosophila_2:1626764_at:293:513; Interrogation_Position=1747; Antisense; GTGATCTTCGCCTGCATGAATGGAT
>probe:Drosophila_2:1626764_at:634:691; Interrogation_Position=1808; Antisense; TTTGGCAACCGCTCTCTAGACTATC
>probe:Drosophila_2:1626764_at:61:685; Interrogation_Position=1829; Antisense; TATCCTATTCCGTCTACATGTGGCA
>probe:Drosophila_2:1626764_at:665:269; Interrogation_Position=1845; Antisense; CATGTGGCACATGTTCTTCCAGGAA
>probe:Drosophila_2:1626764_at:388:689; Interrogation_Position=1900; Antisense; TATTTCTCGAACTACACCATTATGC
>probe:Drosophila_2:1626764_at:702:337; Interrogation_Position=1923; Antisense; GCTCAACTTCTGGTCCACATTTGGA
>probe:Drosophila_2:1626764_at:141:259; Interrogation_Position=1938; Antisense; CACATTTGGATTTGCCGTGCTGTTT
>probe:Drosophila_2:1626764_at:48:319; Interrogation_Position=1951; Antisense; GCCGTGCTGTTTGCTTATGTGATGC
>probe:Drosophila_2:1626764_at:231:615; Interrogation_Position=1973; Antisense; TGCACTTGGTAATTGAGGCGCCTTT
>probe:Drosophila_2:1626764_at:380:67; Interrogation_Position=1988; Antisense; AGGCGCCTTTTGGTGGTCTCGATTA
>probe:Drosophila_2:1626764_at:318:499; Interrogation_Position=2003; Antisense; GTCTCGATTACTTCCTGAGGCCAAA

Paste this into a BLAST search page for me
TTGGCTACAGTCTGCACTTGAACAGAGATCTGTCCACCTTTGCGGAGGCTATGGCCCTCTGCTGGGTGATCTTCGGTGATCTTCGCCTGCATGAATGGATTTTGGCAACCGCTCTCTAGACTATCTATCCTATTCCGTCTACATGTGGCACATGTGGCACATGTTCTTCCAGGAATATTTCTCGAACTACACCATTATGCGCTCAACTTCTGGTCCACATTTGGACACATTTGGATTTGCCGTGCTGTTTGCCGTGCTGTTTGCTTATGTGATGCTGCACTTGGTAATTGAGGCGCCTTTAGGCGCCTTTTGGTGGTCTCGATTAGTCTCGATTACTTCCTGAGGCCAAA

Full Affymetrix probeset data:

Annotations for 1626764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720