FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626765_at:

>probe:Drosophila_2:1626765_at:448:449; Interrogation_Position=789; Antisense; GATCCTCTCAGGCTCATGATGGTGG
>probe:Drosophila_2:1626765_at:172:281; Interrogation_Position=795; Antisense; CTCAGGCTCATGATGGTGGTGTTGC
>probe:Drosophila_2:1626765_at:81:109; Interrogation_Position=855; Antisense; AGAAGGCTAACGCCCAGATCCCCGA
>probe:Drosophila_2:1626765_at:505:625; Interrogation_Position=891; Antisense; TGCCCACTTCTGTGTTCCGTCGTCT
>probe:Drosophila_2:1626765_at:20:469; Interrogation_Position=904; Antisense; GTTCCGTCGTCTGCGTTTCTAGGAA
>probe:Drosophila_2:1626765_at:397:499; Interrogation_Position=912; Antisense; GTCTGCGTTTCTAGGAAGGCTACAT
>probe:Drosophila_2:1626765_at:429:371; Interrogation_Position=926; Antisense; GAAGGCTACATCTTGGACTCCATTA
>probe:Drosophila_2:1626765_at:65:37; Interrogation_Position=935; Antisense; ATCTTGGACTCCATTAACTTAAGCA
>probe:Drosophila_2:1626765_at:339:13; Interrogation_Position=947; Antisense; ATTAACTTAAGCAAATCTCGACTGA
>probe:Drosophila_2:1626765_at:419:357; Interrogation_Position=957; Antisense; GCAAATCTCGACTGAAGAACTCATT
>probe:Drosophila_2:1626765_at:482:211; Interrogation_Position=971; Antisense; AAGAACTCATTCTTCCTGTTACACG
>probe:Drosophila_2:1626765_at:103:13; Interrogation_Position=979; Antisense; ATTCTTCCTGTTACACGTTGTTGAC
>probe:Drosophila_2:1626765_at:507:473; Interrogation_Position=988; Antisense; GTTACACGTTGTTGACTAATGCATA
>probe:Drosophila_2:1626765_at:626:467; Interrogation_Position=998; Antisense; GTTGACTAATGCATAATTACACCAA

Paste this into a BLAST search page for me
GATCCTCTCAGGCTCATGATGGTGGCTCAGGCTCATGATGGTGGTGTTGCAGAAGGCTAACGCCCAGATCCCCGATGCCCACTTCTGTGTTCCGTCGTCTGTTCCGTCGTCTGCGTTTCTAGGAAGTCTGCGTTTCTAGGAAGGCTACATGAAGGCTACATCTTGGACTCCATTAATCTTGGACTCCATTAACTTAAGCAATTAACTTAAGCAAATCTCGACTGAGCAAATCTCGACTGAAGAACTCATTAAGAACTCATTCTTCCTGTTACACGATTCTTCCTGTTACACGTTGTTGACGTTACACGTTGTTGACTAATGCATAGTTGACTAATGCATAATTACACCAA

Full Affymetrix probeset data:

Annotations for 1626765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720