FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626767_at:

>probe:Drosophila_2:1626767_at:381:589; Interrogation_Position=295; Antisense; TGGAGGCACAGTCCTTCTACATCGG
>probe:Drosophila_2:1626767_at:202:509; Interrogation_Position=327; Antisense; GTGCTCATCGGCATCAGCATTGTAA
>probe:Drosophila_2:1626767_at:702:65; Interrogation_Position=390; Antisense; ATGGAGAACACCCTGGCTCTGTTTG
>probe:Drosophila_2:1626767_at:120:79; Interrogation_Position=430; Antisense; AGGTCTTTGGGTTCATCGCCATTGT
>probe:Drosophila_2:1626767_at:398:639; Interrogation_Position=462; Antisense; TCGGCGGTCCTATTGCAGTTCAGCA
>probe:Drosophila_2:1626767_at:278:93; Interrogation_Position=478; Antisense; AGTTCAGCACTATCAACTCGAGCCT
>probe:Drosophila_2:1626767_at:354:335; Interrogation_Position=509; Antisense; GCTGCTGAATGTATCGCTGCGCGGC
>probe:Drosophila_2:1626767_at:211:523; Interrogation_Position=537; Antisense; GTGGCCACATCGGAGTATACGTACT
>probe:Drosophila_2:1626767_at:435:297; Interrogation_Position=562; Antisense; CGAACTACGTGCTGACCATGATTCA
>probe:Drosophila_2:1626767_at:19:521; Interrogation_Position=615; Antisense; GGGCCATGGGATTATCTCGACCTGC
>probe:Drosophila_2:1626767_at:79:121; Interrogation_Position=709; Antisense; AGCTGACCTGGTTCTTCGAGGGCAA
>probe:Drosophila_2:1626767_at:557:175; Interrogation_Position=733; Antisense; AAACCGGCTGGATTGTGGCTCTGGC
>probe:Drosophila_2:1626767_at:727:619; Interrogation_Position=772; Antisense; TGCTCAACGTCATCTGCGCGGTGAT
>probe:Drosophila_2:1626767_at:375:277; Interrogation_Position=800; Antisense; CTTTGTGCTTGTGCAGGCGGTCAAA

Paste this into a BLAST search page for me
TGGAGGCACAGTCCTTCTACATCGGGTGCTCATCGGCATCAGCATTGTAAATGGAGAACACCCTGGCTCTGTTTGAGGTCTTTGGGTTCATCGCCATTGTTCGGCGGTCCTATTGCAGTTCAGCAAGTTCAGCACTATCAACTCGAGCCTGCTGCTGAATGTATCGCTGCGCGGCGTGGCCACATCGGAGTATACGTACTCGAACTACGTGCTGACCATGATTCAGGGCCATGGGATTATCTCGACCTGCAGCTGACCTGGTTCTTCGAGGGCAAAAACCGGCTGGATTGTGGCTCTGGCTGCTCAACGTCATCTGCGCGGTGATCTTTGTGCTTGTGCAGGCGGTCAAA

Full Affymetrix probeset data:

Annotations for 1626767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720