Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626771_at:

>probe:Drosophila_2:1626771_at:687:255; Interrogation_Position=1030; Antisense; CAAACAGTTCTTTCACTTGGACGAA
>probe:Drosophila_2:1626771_at:52:285; Interrogation_Position=1070; Antisense; CTGAACATGGCGCACATTGTCGAAT
>probe:Drosophila_2:1626771_at:430:727; Interrogation_Position=1086; Antisense; TTGTCGAATGCCAAGCACTGGGCCT
>probe:Drosophila_2:1626771_at:330:637; Interrogation_Position=1141; Antisense; TCGACGCTATCGACGTGGCTGTGAA
>probe:Drosophila_2:1626771_at:694:227; Interrogation_Position=1164; Antisense; AATGTGCCGACGAGGACTTTTGCCA
>probe:Drosophila_2:1626771_at:45:725; Interrogation_Position=1220; Antisense; TTGCTCCGACTGCTGTGTGAATTAA
>probe:Drosophila_2:1626771_at:239:679; Interrogation_Position=799; Antisense; TAGTACCAACAGTATTGCCATCCCA
>probe:Drosophila_2:1626771_at:296:5; Interrogation_Position=830; Antisense; ATTGTGGCTACATGTCCGCAACAGG
>probe:Drosophila_2:1626771_at:208:81; Interrogation_Position=852; Antisense; AGGTGCTCAAAGACTGCCGCATCAA
>probe:Drosophila_2:1626771_at:34:161; Interrogation_Position=883; Antisense; ACAACTGAAGACTGAGGCCCTGGCC
>probe:Drosophila_2:1626771_at:321:337; Interrogation_Position=909; Antisense; GCTCCATTATGGGTGCCATCGGGAA
>probe:Drosophila_2:1626771_at:297:313; Interrogation_Position=964; Antisense; GCCACTTATCAACGAGCCGGATCAG
>probe:Drosophila_2:1626771_at:476:453; Interrogation_Position=983; Antisense; GATCAGTGCCATCCTGGTGAGCAGA
>probe:Drosophila_2:1626771_at:682:511; Interrogation_Position=999; Antisense; GTGAGCAGAACACCTGTGACCACTA

Paste this into a BLAST search page for me
CAAACAGTTCTTTCACTTGGACGAACTGAACATGGCGCACATTGTCGAATTTGTCGAATGCCAAGCACTGGGCCTTCGACGCTATCGACGTGGCTGTGAAAATGTGCCGACGAGGACTTTTGCCATTGCTCCGACTGCTGTGTGAATTAATAGTACCAACAGTATTGCCATCCCAATTGTGGCTACATGTCCGCAACAGGAGGTGCTCAAAGACTGCCGCATCAAACAACTGAAGACTGAGGCCCTGGCCGCTCCATTATGGGTGCCATCGGGAAGCCACTTATCAACGAGCCGGATCAGGATCAGTGCCATCCTGGTGAGCAGAGTGAGCAGAACACCTGTGACCACTA

Full Affymetrix probeset data:

Annotations for 1626771_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime