FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626772_at:

>probe:Drosophila_2:1626772_at:672:97; Interrogation_Position=308; Antisense; AGATCCTGGATCTCTCGCAGAATAT
>probe:Drosophila_2:1626772_at:312:365; Interrogation_Position=327; Antisense; GAATATCATCGAAACGCTGGGCTCG
>probe:Drosophila_2:1626772_at:481:295; Interrogation_Position=383; Antisense; CCCTGAATCTGAGCCGGAATTTGGT
>probe:Drosophila_2:1626772_at:56:365; Interrogation_Position=399; Antisense; GAATTTGGTCAGTTCCCTGCACAAA
>probe:Drosophila_2:1626772_at:341:223; Interrogation_Position=433; Antisense; AAGGGTCTGACCAATCTGTTGCTTC
>probe:Drosophila_2:1626772_at:199:649; Interrogation_Position=554; Antisense; TCAGCTTGGAGGACAACTGCTTCAA
>probe:Drosophila_2:1626772_at:530:277; Interrogation_Position=592; Antisense; CTAGAGGTTCTCGTGTTCCGGAATA
>probe:Drosophila_2:1626772_at:197:465; Interrogation_Position=620; Antisense; GATTGCTAGACGTTCCAGCCAGTAA
>probe:Drosophila_2:1626772_at:23:725; Interrogation_Position=655; Antisense; TTGCATGCCCTCAAGAGCCTGGATA
>probe:Drosophila_2:1626772_at:325:681; Interrogation_Position=678; Antisense; TATGTCCTTGAATCTGGTCGAGTTT
>probe:Drosophila_2:1626772_at:499:709; Interrogation_Position=727; Antisense; TTAAAGGAGCTTTTGGCCCTCAGCG
>probe:Drosophila_2:1626772_at:316:415; Interrogation_Position=768; Antisense; GAGCGAACTGGATTTGAGTGCCTTC
>probe:Drosophila_2:1626772_at:355:505; Interrogation_Position=785; Antisense; GTGCCTTCGAGGGACTTATATCCTT
>probe:Drosophila_2:1626772_at:633:545; Interrogation_Position=819; Antisense; GGATCTGTCCGATAATAATCTCACG

Paste this into a BLAST search page for me
AGATCCTGGATCTCTCGCAGAATATGAATATCATCGAAACGCTGGGCTCGCCCTGAATCTGAGCCGGAATTTGGTGAATTTGGTCAGTTCCCTGCACAAAAAGGGTCTGACCAATCTGTTGCTTCTCAGCTTGGAGGACAACTGCTTCAACTAGAGGTTCTCGTGTTCCGGAATAGATTGCTAGACGTTCCAGCCAGTAATTGCATGCCCTCAAGAGCCTGGATATATGTCCTTGAATCTGGTCGAGTTTTTAAAGGAGCTTTTGGCCCTCAGCGGAGCGAACTGGATTTGAGTGCCTTCGTGCCTTCGAGGGACTTATATCCTTGGATCTGTCCGATAATAATCTCACG

Full Affymetrix probeset data:

Annotations for 1626772_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720