FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626776_at:

>probe:Drosophila_2:1626776_at:363:363; Interrogation_Position=439; Antisense; TTTTGGCGAAATGTCCACCCGGATC
>probe:Drosophila_2:1626776_at:583:123; Interrogation_Position=488; Antisense; AGCCCTTGGTCACATGGGATCCGAA
>probe:Drosophila_2:1626776_at:667:395; Interrogation_Position=535; Antisense; GAAATTGGTCCCGATAACCACGACA
>probe:Drosophila_2:1626776_at:107:577; Interrogation_Position=697; Antisense; GGCGCCGCTGTTACCACTGGAGATG
>probe:Drosophila_2:1626776_at:322:441; Interrogation_Position=718; Antisense; GATGGAGACATCCTTATGCGCTTCC
>probe:Drosophila_2:1626776_at:139:439; Interrogation_Position=793; Antisense; GAGGCAGTCGAGTTGGTCATCCAGC
>probe:Drosophila_2:1626776_at:141:325; Interrogation_Position=816; Antisense; GCGAATCCAGAAGCACGTAAAGTAT
>probe:Drosophila_2:1626776_at:126:373; Interrogation_Position=844; Antisense; GAAGTCGCCGTTATCGTTGCAAACC
>probe:Drosophila_2:1626776_at:566:709; Interrogation_Position=860; Antisense; TTGCAAACCGGCTTGGAACGTACGC
>probe:Drosophila_2:1626776_at:552:197; Interrogation_Position=876; Antisense; AACGTACGCAGTCAGGTGCCATGGT
>probe:Drosophila_2:1626776_at:45:3; Interrogation_Position=935; Antisense; ATATGGTCAGTAGTCCGGGACAACC
>probe:Drosophila_2:1626776_at:664:157; Interrogation_Position=954; Antisense; ACAACCGGTGCGCACGGAATCGGTT
>probe:Drosophila_2:1626776_at:179:41; Interrogation_Position=972; Antisense; ATCGGTTGAGTGCTCAGCGAATCCT
>probe:Drosophila_2:1626776_at:364:285; Interrogation_Position=995; Antisense; CTGAGAAATCTCCTTCCGAAGACGA

Paste this into a BLAST search page for me
TTTTGGCGAAATGTCCACCCGGATCAGCCCTTGGTCACATGGGATCCGAAGAAATTGGTCCCGATAACCACGACAGGCGCCGCTGTTACCACTGGAGATGGATGGAGACATCCTTATGCGCTTCCGAGGCAGTCGAGTTGGTCATCCAGCGCGAATCCAGAAGCACGTAAAGTATGAAGTCGCCGTTATCGTTGCAAACCTTGCAAACCGGCTTGGAACGTACGCAACGTACGCAGTCAGGTGCCATGGTATATGGTCAGTAGTCCGGGACAACCACAACCGGTGCGCACGGAATCGGTTATCGGTTGAGTGCTCAGCGAATCCTCTGAGAAATCTCCTTCCGAAGACGA

Full Affymetrix probeset data:

Annotations for 1626776_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720