FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626781_at:

>probe:Drosophila_2:1626781_at:221:705; Interrogation_Position=2687; Antisense; TTATGTGTGGCATACTTTGGCGCGC
>probe:Drosophila_2:1626781_at:227:561; Interrogation_Position=2725; Antisense; GGAAAATTCCCTTTCGCGATAGAAG
>probe:Drosophila_2:1626781_at:173:325; Interrogation_Position=2740; Antisense; GCGATAGAAGAAAACCAACCCATAA
>probe:Drosophila_2:1626781_at:55:269; Interrogation_Position=2760; Antisense; CATAACGTAACCCATAACCTAGCTT
>probe:Drosophila_2:1626781_at:40:393; Interrogation_Position=2849; Antisense; GAAAGAGCTAATTGAAATCCCTCCC
>probe:Drosophila_2:1626781_at:74:445; Interrogation_Position=2897; Antisense; GATGAAAAACCCCAGCAGAATCCCC
>probe:Drosophila_2:1626781_at:215:301; Interrogation_Position=2918; Antisense; CCCCATAATCCCCAGAGGCAAGAAA
>probe:Drosophila_2:1626781_at:263:235; Interrogation_Position=2975; Antisense; AATCCAGCGCTAATCTGTTCCAAAC
>probe:Drosophila_2:1626781_at:389:683; Interrogation_Position=2992; Antisense; TTCCAAACATTTAGCAGCGGCAAAA
>probe:Drosophila_2:1626781_at:381:707; Interrogation_Position=3050; Antisense; TTAGAAATATCGAGGCGCAGTGCCG
>probe:Drosophila_2:1626781_at:30:577; Interrogation_Position=3063; Antisense; GGCGCAGTGCCGAGATGCAACCGAA
>probe:Drosophila_2:1626781_at:560:31; Interrogation_Position=3129; Antisense; ATAATCGTAATCCTTGAACTCTAGA
>probe:Drosophila_2:1626781_at:28:393; Interrogation_Position=3201; Antisense; GAAACCATTTGCAATATGTGCCGCA
>probe:Drosophila_2:1626781_at:220:507; Interrogation_Position=3218; Antisense; GTGCCGCAATAGTCCATAAATGTTC

Paste this into a BLAST search page for me
TTATGTGTGGCATACTTTGGCGCGCGGAAAATTCCCTTTCGCGATAGAAGGCGATAGAAGAAAACCAACCCATAACATAACGTAACCCATAACCTAGCTTGAAAGAGCTAATTGAAATCCCTCCCGATGAAAAACCCCAGCAGAATCCCCCCCCATAATCCCCAGAGGCAAGAAAAATCCAGCGCTAATCTGTTCCAAACTTCCAAACATTTAGCAGCGGCAAAATTAGAAATATCGAGGCGCAGTGCCGGGCGCAGTGCCGAGATGCAACCGAAATAATCGTAATCCTTGAACTCTAGAGAAACCATTTGCAATATGTGCCGCAGTGCCGCAATAGTCCATAAATGTTC

Full Affymetrix probeset data:

Annotations for 1626781_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720