FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626782_at:

>probe:Drosophila_2:1626782_at:714:457; Interrogation_Position=226; Antisense; GATAGTCTGCTTATTTCAACCGTCG
>probe:Drosophila_2:1626782_at:365:357; Interrogation_Position=253; Antisense; GAATCGGGCGACACGGAGCAATTTA
>probe:Drosophila_2:1626782_at:730:17; Interrogation_Position=329; Antisense; ATTTAAGTCCACGTGAATCGGCTCA
>probe:Drosophila_2:1626782_at:54:237; Interrogation_Position=344; Antisense; AATCGGCTCATTTTACTCGCAAGAA
>probe:Drosophila_2:1626782_at:483:221; Interrogation_Position=404; Antisense; AAGTGTTCATGTTTGTGGCCGGCTA
>probe:Drosophila_2:1626782_at:663:551; Interrogation_Position=447; Antisense; GGAGCTCACCTTCATTGACTATTTG
>probe:Drosophila_2:1626782_at:225:145; Interrogation_Position=480; Antisense; ACTGCCTGTGAATTACGCCGGTCAT
>probe:Drosophila_2:1626782_at:263:647; Interrogation_Position=501; Antisense; TCATGGCTATGGTGCGATCTTCGCA
>probe:Drosophila_2:1626782_at:346:347; Interrogation_Position=523; Antisense; GCATCCAGCATCTATGACCGATACT
>probe:Drosophila_2:1626782_at:107:547; Interrogation_Position=570; Antisense; GGAGGCCTACGACGTCTTCAAGAAG
>probe:Drosophila_2:1626782_at:487:343; Interrogation_Position=596; Antisense; GCATTGCCGAAATCCAGAAGCGCCT
>probe:Drosophila_2:1626782_at:622:575; Interrogation_Position=620; Antisense; TGGTCGTCAACCTCAAGAACTTCAC
>probe:Drosophila_2:1626782_at:254:21; Interrogation_Position=677; Antisense; ATTTGGAGCCAATCAGCGCTGCTAG
>probe:Drosophila_2:1626782_at:223:167; Interrogation_Position=756; Antisense; AAATGCGTCTGGATTCTTGGCTAAT

Paste this into a BLAST search page for me
GATAGTCTGCTTATTTCAACCGTCGGAATCGGGCGACACGGAGCAATTTAATTTAAGTCCACGTGAATCGGCTCAAATCGGCTCATTTTACTCGCAAGAAAAGTGTTCATGTTTGTGGCCGGCTAGGAGCTCACCTTCATTGACTATTTGACTGCCTGTGAATTACGCCGGTCATTCATGGCTATGGTGCGATCTTCGCAGCATCCAGCATCTATGACCGATACTGGAGGCCTACGACGTCTTCAAGAAGGCATTGCCGAAATCCAGAAGCGCCTTGGTCGTCAACCTCAAGAACTTCACATTTGGAGCCAATCAGCGCTGCTAGAAATGCGTCTGGATTCTTGGCTAAT

Full Affymetrix probeset data:

Annotations for 1626782_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720