FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626783_at:

>probe:Drosophila_2:1626783_at:394:253; Interrogation_Position=110; Antisense; CAAGCGTTTCCTGCGCTGTGAACTG
>probe:Drosophila_2:1626783_at:442:319; Interrogation_Position=135; Antisense; GCCCGCAAGTTGCTCGATCAGCATG
>probe:Drosophila_2:1626783_at:175:33; Interrogation_Position=151; Antisense; ATCAGCATGGTTTCGAACGCAGTCT
>probe:Drosophila_2:1626783_at:433:199; Interrogation_Position=166; Antisense; AACGCAGTCTGCTCTCGAATTGGAT
>probe:Drosophila_2:1626783_at:700:255; Interrogation_Position=204; Antisense; CACGAAAGCGATCTGGATACCGGCA
>probe:Drosophila_2:1626783_at:619:241; Interrogation_Position=21; Antisense; AATATGAGAGCTGCGCCATTCGGAT
>probe:Drosophila_2:1626783_at:578:455; Interrogation_Position=219; Antisense; GATACCGGCAGGATTACAACCAATG
>probe:Drosophila_2:1626783_at:288:229; Interrogation_Position=246; Antisense; AATGGATCTCGGAACTATGGGCTGT
>probe:Drosophila_2:1626783_at:485:681; Interrogation_Position=261; Antisense; TATGGGCTGTTCCAAATCAATGGCA
>probe:Drosophila_2:1626783_at:253:223; Interrogation_Position=356; Antisense; AAGGGAGTCGGTTACTTGCGCCAAG
>probe:Drosophila_2:1626783_at:435:307; Interrogation_Position=36; Antisense; CCATTCGGATCGTGGTACTGGCTGG
>probe:Drosophila_2:1626783_at:582:281; Interrogation_Position=392; Antisense; CTCGGATGGTTTTCGTCATTGGGCA
>probe:Drosophila_2:1626783_at:224:137; Interrogation_Position=425; Antisense; ACGATATTGCCGAAACGCCCAAAAT
>probe:Drosophila_2:1626783_at:471:133; Interrogation_Position=439; Antisense; ACGCCCAAAATCTGCCTAATCTTAA

Paste this into a BLAST search page for me
CAAGCGTTTCCTGCGCTGTGAACTGGCCCGCAAGTTGCTCGATCAGCATGATCAGCATGGTTTCGAACGCAGTCTAACGCAGTCTGCTCTCGAATTGGATCACGAAAGCGATCTGGATACCGGCAAATATGAGAGCTGCGCCATTCGGATGATACCGGCAGGATTACAACCAATGAATGGATCTCGGAACTATGGGCTGTTATGGGCTGTTCCAAATCAATGGCAAAGGGAGTCGGTTACTTGCGCCAAGCCATTCGGATCGTGGTACTGGCTGGCTCGGATGGTTTTCGTCATTGGGCAACGATATTGCCGAAACGCCCAAAATACGCCCAAAATCTGCCTAATCTTAA

Full Affymetrix probeset data:

Annotations for 1626783_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720