FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626785_at:

>probe:Drosophila_2:1626785_at:229:579; Interrogation_Position=1031; Antisense; TGGCCACCGACTTCGAAATTGGTCA
>probe:Drosophila_2:1626785_at:409:635; Interrogation_Position=1043; Antisense; TCGAAATTGGTCACTTCTTGCGCGC
>probe:Drosophila_2:1626785_at:684:645; Interrogation_Position=1058; Antisense; TCTTGCGCGCCAGAATTATTCCAAA
>probe:Drosophila_2:1626785_at:100:619; Interrogation_Position=1088; Antisense; TGCTTTACTACACTGGCGACATCGT
>probe:Drosophila_2:1626785_at:57:221; Interrogation_Position=1195; Antisense; AAGGGCCCCAAATCAGCCGGTATCA
>probe:Drosophila_2:1626785_at:529:135; Interrogation_Position=1235; Antisense; ACGACTGCCCGAATCAGTAGGTTGA
>probe:Drosophila_2:1626785_at:327:415; Interrogation_Position=1361; Antisense; GAGCTGAACTCGAATAAACCTACAT
>probe:Drosophila_2:1626785_at:427:447; Interrogation_Position=796; Antisense; GATCCGTTCGCATTTGAAGGCCCAG
>probe:Drosophila_2:1626785_at:267:369; Interrogation_Position=811; Antisense; GAAGGCCCAGAGATCTACAAGTGCA
>probe:Drosophila_2:1626785_at:108:381; Interrogation_Position=867; Antisense; GAACCTTACTGTGAAGACCATCCGC
>probe:Drosophila_2:1626785_at:667:323; Interrogation_Position=917; Antisense; GCGCAGTGCGCACCATTGTGAAGCA
>probe:Drosophila_2:1626785_at:400:723; Interrogation_Position=932; Antisense; TTGTGAAGCAGGTTCCGACGGATTC
>probe:Drosophila_2:1626785_at:422:353; Interrogation_Position=948; Antisense; GACGGATTCCTTCTTCAATTTCTTC
>probe:Drosophila_2:1626785_at:502:653; Interrogation_Position=962; Antisense; TCAATTTCTTCAGCCCACCAGAGGT

Paste this into a BLAST search page for me
TGGCCACCGACTTCGAAATTGGTCATCGAAATTGGTCACTTCTTGCGCGCTCTTGCGCGCCAGAATTATTCCAAATGCTTTACTACACTGGCGACATCGTAAGGGCCCCAAATCAGCCGGTATCAACGACTGCCCGAATCAGTAGGTTGAGAGCTGAACTCGAATAAACCTACATGATCCGTTCGCATTTGAAGGCCCAGGAAGGCCCAGAGATCTACAAGTGCAGAACCTTACTGTGAAGACCATCCGCGCGCAGTGCGCACCATTGTGAAGCATTGTGAAGCAGGTTCCGACGGATTCGACGGATTCCTTCTTCAATTTCTTCTCAATTTCTTCAGCCCACCAGAGGT

Full Affymetrix probeset data:

Annotations for 1626785_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720