Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626786_at:

>probe:Drosophila_2:1626786_at:587:627; Interrogation_Position=2861; Antisense; TCCAAAGCGACAATTTCCAGGTGAA
>probe:Drosophila_2:1626786_at:213:625; Interrogation_Position=2952; Antisense; TGCCACCAAGGAGAACGTCACGCTT
>probe:Drosophila_2:1626786_at:481:183; Interrogation_Position=2978; Antisense; AAAAGTTCGTGACCCTGCGCGAGGC
>probe:Drosophila_2:1626786_at:539:249; Interrogation_Position=3003; Antisense; CAATGGGCCGAGTGACGAGACTGAT
>probe:Drosophila_2:1626786_at:541:143; Interrogation_Position=3022; Antisense; ACTGATATTTGATCGACGGCGTCTG
>probe:Drosophila_2:1626786_at:289:421; Interrogation_Position=3080; Antisense; GAGAAGTTAGTGTCCCTGGCCAGAG
>probe:Drosophila_2:1626786_at:425:97; Interrogation_Position=3101; Antisense; AGAGTCACAAAACAGCGGCGCCTAA
>probe:Drosophila_2:1626786_at:571:199; Interrogation_Position=3125; Antisense; AACGCAGGCCAAAATCCAAGTTCAG
>probe:Drosophila_2:1626786_at:514:137; Interrogation_Position=3162; Antisense; ACGTCAGTAGTTTTATACCTCAGTG
>probe:Drosophila_2:1626786_at:644:245; Interrogation_Position=3235; Antisense; AATTAATCGTATTGCTATCCCGGCG
>probe:Drosophila_2:1626786_at:152:573; Interrogation_Position=3256; Antisense; GGCGCCTTACCAGTAATCTGATACC
>probe:Drosophila_2:1626786_at:545:641; Interrogation_Position=3272; Antisense; TCTGATACCAACTACTGGCCAATGG
>probe:Drosophila_2:1626786_at:60:107; Interrogation_Position=3355; Antisense; AGAAATCTTGGCCAAGCTGCCGCTT
>probe:Drosophila_2:1626786_at:566:595; Interrogation_Position=3381; Antisense; TGTGTGCATCTAGGCCTTCAGTGTG

Paste this into a BLAST search page for me
TCCAAAGCGACAATTTCCAGGTGAATGCCACCAAGGAGAACGTCACGCTTAAAAGTTCGTGACCCTGCGCGAGGCCAATGGGCCGAGTGACGAGACTGATACTGATATTTGATCGACGGCGTCTGGAGAAGTTAGTGTCCCTGGCCAGAGAGAGTCACAAAACAGCGGCGCCTAAAACGCAGGCCAAAATCCAAGTTCAGACGTCAGTAGTTTTATACCTCAGTGAATTAATCGTATTGCTATCCCGGCGGGCGCCTTACCAGTAATCTGATACCTCTGATACCAACTACTGGCCAATGGAGAAATCTTGGCCAAGCTGCCGCTTTGTGTGCATCTAGGCCTTCAGTGTG

Full Affymetrix probeset data:

Annotations for 1626786_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime