Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626787_s_at:

>probe:Drosophila_2:1626787_s_at:621:479; Interrogation_Position=1061; Antisense; GTTTCCAGTTTCTGTTCTTTAAGCA
>probe:Drosophila_2:1626787_s_at:513:75; Interrogation_Position=671; Antisense; AGGAGGTTTTGCTGCACAATCCGCA
>probe:Drosophila_2:1626787_s_at:234:615; Interrogation_Position=683; Antisense; TGCACAATCCGCATAGCCATCTAAT
>probe:Drosophila_2:1626787_s_at:166:673; Interrogation_Position=696; Antisense; TAGCCATCTAATACACCAGCGTTTG
>probe:Drosophila_2:1626787_s_at:351:455; Interrogation_Position=731; Antisense; GATACACAATGGGTGGCGTCGAGAA
>probe:Drosophila_2:1626787_s_at:246:23; Interrogation_Position=755; Antisense; ATATGGAATCGGCTCGCACTTACTA
>probe:Drosophila_2:1626787_s_at:179:357; Interrogation_Position=770; Antisense; GCACTTACTATTCGCAGGCCCTGAA
>probe:Drosophila_2:1626787_s_at:706:69; Interrogation_Position=785; Antisense; AGGCCCTGAAGCTTAATCCGCATAA
>probe:Drosophila_2:1626787_s_at:722:653; Interrogation_Position=798; Antisense; TAATCCGCATAACTTGAGGGCCCTT
>probe:Drosophila_2:1626787_s_at:693:427; Interrogation_Position=813; Antisense; GAGGGCCCTTTATGGCATTTACTTG
>probe:Drosophila_2:1626787_s_at:580:569; Interrogation_Position=826; Antisense; GGCATTTACTTGTGCTGCAACCATT
>probe:Drosophila_2:1626787_s_at:91:335; Interrogation_Position=839; Antisense; GCTGCAACCATTTGGACAACTCTCG
>probe:Drosophila_2:1626787_s_at:697:581; Interrogation_Position=907; Antisense; TGGGCCCTCGAACAACTTTTGACTA
>probe:Drosophila_2:1626787_s_at:17:257; Interrogation_Position=934; Antisense; CAAACGATTGTACCCTTGGAGGCTG

Paste this into a BLAST search page for me
GTTTCCAGTTTCTGTTCTTTAAGCAAGGAGGTTTTGCTGCACAATCCGCATGCACAATCCGCATAGCCATCTAATTAGCCATCTAATACACCAGCGTTTGGATACACAATGGGTGGCGTCGAGAAATATGGAATCGGCTCGCACTTACTAGCACTTACTATTCGCAGGCCCTGAAAGGCCCTGAAGCTTAATCCGCATAATAATCCGCATAACTTGAGGGCCCTTGAGGGCCCTTTATGGCATTTACTTGGGCATTTACTTGTGCTGCAACCATTGCTGCAACCATTTGGACAACTCTCGTGGGCCCTCGAACAACTTTTGACTACAAACGATTGTACCCTTGGAGGCTG

Full Affymetrix probeset data:

Annotations for 1626787_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime