FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626789_at:

>probe:Drosophila_2:1626789_at:17:31; Interrogation_Position=438; Antisense; ATAAATCTGCGCCAGGCCTTGAAGA
>probe:Drosophila_2:1626789_at:37:381; Interrogation_Position=511; Antisense; GAACCGATCTGGATAAGCACTTGAT
>probe:Drosophila_2:1626789_at:457:703; Interrogation_Position=535; Antisense; TTATCTGTGATAGCCGAACGGATCG
>probe:Drosophila_2:1626789_at:452:3; Interrogation_Position=570; Antisense; ATTGGCGACTACGAGATGTCCGGCC
>probe:Drosophila_2:1626789_at:663:69; Interrogation_Position=628; Antisense; AGGCCAATGTCACGCTGATCAACAC
>probe:Drosophila_2:1626789_at:496:215; Interrogation_Position=654; Antisense; AAGATCGAGCATCGCCTGATCGGCG
>probe:Drosophila_2:1626789_at:264:285; Interrogation_Position=669; Antisense; CTGATCGGCGAACCCTTTGAGAAGG
>probe:Drosophila_2:1626789_at:168:441; Interrogation_Position=693; Antisense; GATGGCGTCAAGTACATGCGACTAA
>probe:Drosophila_2:1626789_at:65:43; Interrogation_Position=708; Antisense; ATGCGACTAAAGGACTACCGGGTGT
>probe:Drosophila_2:1626789_at:521:279; Interrogation_Position=824; Antisense; CTGGGAGACGGTGTTCAACGAACTA
>probe:Drosophila_2:1626789_at:391:99; Interrogation_Position=865; Antisense; AGAGTTTCGGCATCATCTTCAGGGA
>probe:Drosophila_2:1626789_at:11:83; Interrogation_Position=885; Antisense; AGGGAGCTGTCCAACAAACTGTTCG
>probe:Drosophila_2:1626789_at:486:177; Interrogation_Position=900; Antisense; AAACTGTTCGAGAAAGTGCCCTTCG
>probe:Drosophila_2:1626789_at:270:155; Interrogation_Position=953; Antisense; ACAGCTTTCAATTACGTACCTATTA

Paste this into a BLAST search page for me
ATAAATCTGCGCCAGGCCTTGAAGAGAACCGATCTGGATAAGCACTTGATTTATCTGTGATAGCCGAACGGATCGATTGGCGACTACGAGATGTCCGGCCAGGCCAATGTCACGCTGATCAACACAAGATCGAGCATCGCCTGATCGGCGCTGATCGGCGAACCCTTTGAGAAGGGATGGCGTCAAGTACATGCGACTAAATGCGACTAAAGGACTACCGGGTGTCTGGGAGACGGTGTTCAACGAACTAAGAGTTTCGGCATCATCTTCAGGGAAGGGAGCTGTCCAACAAACTGTTCGAAACTGTTCGAGAAAGTGCCCTTCGACAGCTTTCAATTACGTACCTATTA

Full Affymetrix probeset data:

Annotations for 1626789_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720