Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626791_at:

>probe:Drosophila_2:1626791_at:435:221; Interrogation_Position=1054; Antisense; AAGTGGCGCTTATCCGGCAGCGGAA
>probe:Drosophila_2:1626791_at:256:613; Interrogation_Position=1097; Antisense; TGAAAGACGCCGAGCTTGAGCAAAT
>probe:Drosophila_2:1626791_at:218:457; Interrogation_Position=1132; Antisense; GATACTTGCGACAACTGCCGAACAT
>probe:Drosophila_2:1626791_at:214:717; Interrogation_Position=1184; Antisense; TTCGGCGGCAGCTTATGCCTAACAA
>probe:Drosophila_2:1626791_at:564:661; Interrogation_Position=1203; Antisense; TAACAAAATGGCCTGCCTTCTCTTC
>probe:Drosophila_2:1626791_at:619:111; Interrogation_Position=1295; Antisense; AGCACTTCGGGCAGCTCATCAATAG
>probe:Drosophila_2:1626791_at:325:565; Interrogation_Position=1321; Antisense; GGCAAATTCCAGCAGTACGACTACC
>probe:Drosophila_2:1626791_at:645:301; Interrogation_Position=1351; Antisense; CCCCGGCTGAATACGCTGCGATATG
>probe:Drosophila_2:1626791_at:578:35; Interrogation_Position=1397; Antisense; ATCAGTTGGCCAATGTACGCCTGCA
>probe:Drosophila_2:1626791_at:652:265; Interrogation_Position=1510; Antisense; CAGATGTATCAGGTGCCGGGCTATA
>probe:Drosophila_2:1626791_at:37:627; Interrogation_Position=1523; Antisense; TGCCGGGCTATAATCACATTGACTT
>probe:Drosophila_2:1626791_at:294:311; Interrogation_Position=1569; Antisense; CCAAGTGGTCTTTCAGCGCATTATT
>probe:Drosophila_2:1626791_at:228:123; Interrogation_Position=1583; Antisense; AGCGCATTATTCAACAGGCCTGGCA
>probe:Drosophila_2:1626791_at:685:557; Interrogation_Position=1611; Antisense; GGACATGGCATTGGCGGCGCTTTAA

Paste this into a BLAST search page for me
AAGTGGCGCTTATCCGGCAGCGGAATGAAAGACGCCGAGCTTGAGCAAATGATACTTGCGACAACTGCCGAACATTTCGGCGGCAGCTTATGCCTAACAATAACAAAATGGCCTGCCTTCTCTTCAGCACTTCGGGCAGCTCATCAATAGGGCAAATTCCAGCAGTACGACTACCCCCCGGCTGAATACGCTGCGATATGATCAGTTGGCCAATGTACGCCTGCACAGATGTATCAGGTGCCGGGCTATATGCCGGGCTATAATCACATTGACTTCCAAGTGGTCTTTCAGCGCATTATTAGCGCATTATTCAACAGGCCTGGCAGGACATGGCATTGGCGGCGCTTTAA

Full Affymetrix probeset data:

Annotations for 1626791_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime