FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626793_at:

>probe:Drosophila_2:1626793_at:507:273; Interrogation_Position=1202; Antisense; CTTGCGTTACCACCAACCAATTATA
>probe:Drosophila_2:1626793_at:426:157; Interrogation_Position=1229; Antisense; ACAACTTCAACGTGGCTCTGTTTCA
>probe:Drosophila_2:1626793_at:360:641; Interrogation_Position=1245; Antisense; TCTGTTTCATTGGTTGCCCGCTTAC
>probe:Drosophila_2:1626793_at:585:631; Interrogation_Position=1271; Antisense; TCCTGGACTTCCTGATGCTGATATT
>probe:Drosophila_2:1626793_at:554:215; Interrogation_Position=1330; Antisense; AAGATATCCACAGGTCTGGGCGTCC
>probe:Drosophila_2:1626793_at:147:91; Interrogation_Position=1358; Antisense; AGTTCTTTACCCTCAATGCCTGGTG
>probe:Drosophila_2:1626793_at:433:509; Interrogation_Position=1380; Antisense; GTGCTTCCGATCTGATAACTACGCC
>probe:Drosophila_2:1626793_at:723:523; Interrogation_Position=1503; Antisense; GGGCGCTCGAAAGTTTATCCTCAAG
>probe:Drosophila_2:1626793_at:439:623; Interrogation_Position=1551; Antisense; TGCGCGCGTGCACATGAAGATCCAA
>probe:Drosophila_2:1626793_at:493:465; Interrogation_Position=1605; Antisense; GATTGTGGGACTGTTCTTCTACTAC
>probe:Drosophila_2:1626793_at:17:699; Interrogation_Position=1618; Antisense; TTCTTCTACTACCTCCTTAAGTGGA
>probe:Drosophila_2:1626793_at:654:531; Interrogation_Position=1646; Antisense; GGGTGCTGGCTATATTCTGATTCTA
>probe:Drosophila_2:1626793_at:428:9; Interrogation_Position=1659; Antisense; ATTCTGATTCTAGTTCTCCGTGGAC
>probe:Drosophila_2:1626793_at:42:151; Interrogation_Position=1682; Antisense; ACTTGCATTGGTTTGGTGGTCACAG

Paste this into a BLAST search page for me
CTTGCGTTACCACCAACCAATTATAACAACTTCAACGTGGCTCTGTTTCATCTGTTTCATTGGTTGCCCGCTTACTCCTGGACTTCCTGATGCTGATATTAAGATATCCACAGGTCTGGGCGTCCAGTTCTTTACCCTCAATGCCTGGTGGTGCTTCCGATCTGATAACTACGCCGGGCGCTCGAAAGTTTATCCTCAAGTGCGCGCGTGCACATGAAGATCCAAGATTGTGGGACTGTTCTTCTACTACTTCTTCTACTACCTCCTTAAGTGGAGGGTGCTGGCTATATTCTGATTCTAATTCTGATTCTAGTTCTCCGTGGACACTTGCATTGGTTTGGTGGTCACAG

Full Affymetrix probeset data:

Annotations for 1626793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720