FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626800_at:

>probe:Drosophila_2:1626800_at:9:377; Interrogation_Position=1309; Antisense; GAAGAACGATATCCGCAGGCCATAG
>probe:Drosophila_2:1626800_at:237:641; Interrogation_Position=1359; Antisense; TCTGGTCACCGCCTTTGATTTACAT
>probe:Drosophila_2:1626800_at:347:693; Interrogation_Position=1372; Antisense; TTTGATTTACATGCCACTCTCCAGA
>probe:Drosophila_2:1626800_at:97:365; Interrogation_Position=1484; Antisense; GAATAAGTCTTTTCTTGCCCATTCC
>probe:Drosophila_2:1626800_at:397:719; Interrogation_Position=1498; Antisense; TTGCCCATTCCAGACCATAGAGACT
>probe:Drosophila_2:1626800_at:35:273; Interrogation_Position=1513; Antisense; CATAGAGACTGTTTCTTGGCCGCCA
>probe:Drosophila_2:1626800_at:201:515; Interrogation_Position=1557; Antisense; GTGTCAGCAGCCTAGAAATGTCTCG
>probe:Drosophila_2:1626800_at:84:393; Interrogation_Position=1571; Antisense; GAAATGTCTCGACTTCAGATGGCTA
>probe:Drosophila_2:1626800_at:653:265; Interrogation_Position=1586; Antisense; CAGATGGCTATGTTCAGCGGGCAGC
>probe:Drosophila_2:1626800_at:650:525; Interrogation_Position=1604; Antisense; GGGCAGCCCGTCTCATTATTCGAAA
>probe:Drosophila_2:1626800_at:431:615; Interrogation_Position=1663; Antisense; TGCAAGACTTTATACCTGGATCGGG
>probe:Drosophila_2:1626800_at:391:701; Interrogation_Position=1739; Antisense; TTAGGGTGCGACTGATAGCCACTCC
>probe:Drosophila_2:1626800_at:367:405; Interrogation_Position=1819; Antisense; GACGGGCATATATCACGCGTTAATG
>probe:Drosophila_2:1626800_at:60:571; Interrogation_Position=1855; Antisense; GGCTCGCAGTGCATTAGGAACTACT

Paste this into a BLAST search page for me
GAAGAACGATATCCGCAGGCCATAGTCTGGTCACCGCCTTTGATTTACATTTTGATTTACATGCCACTCTCCAGAGAATAAGTCTTTTCTTGCCCATTCCTTGCCCATTCCAGACCATAGAGACTCATAGAGACTGTTTCTTGGCCGCCAGTGTCAGCAGCCTAGAAATGTCTCGGAAATGTCTCGACTTCAGATGGCTACAGATGGCTATGTTCAGCGGGCAGCGGGCAGCCCGTCTCATTATTCGAAATGCAAGACTTTATACCTGGATCGGGTTAGGGTGCGACTGATAGCCACTCCGACGGGCATATATCACGCGTTAATGGGCTCGCAGTGCATTAGGAACTACT

Full Affymetrix probeset data:

Annotations for 1626800_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720