FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626801_at:

>probe:Drosophila_2:1626801_at:38:221; Interrogation_Position=1011; Antisense; CAAGTACTACCCCTTTTCAATTGAG
>probe:Drosophila_2:1626801_at:557:477; Interrogation_Position=1035; Antisense; GTTTTAAACCAGATGAGCGCCTTGT
>probe:Drosophila_2:1626801_at:162:323; Interrogation_Position=1051; Antisense; GCGCCTTGTTGCTGTATCACGAATA
>probe:Drosophila_2:1626801_at:364:535; Interrogation_Position=558; Antisense; GGTGCGCAGCATCGGAGTATCCAAC
>probe:Drosophila_2:1626801_at:411:483; Interrogation_Position=574; Antisense; GTATCCAACTTCAACAGCGAGCAGC
>probe:Drosophila_2:1626801_at:515:571; Interrogation_Position=675; Antisense; GGCTTTGACAGCCTTCTGCAAGAAG
>probe:Drosophila_2:1626801_at:5:607; Interrogation_Position=713; Antisense; TGACGGGCTACACGCCTTTGGGAAA
>probe:Drosophila_2:1626801_at:454:557; Interrogation_Position=762; Antisense; GGACTTTATCTATTCGCCGGAGGTG
>probe:Drosophila_2:1626801_at:442:25; Interrogation_Position=804; Antisense; ATATGGCAAGACTACACCGCAGATT
>probe:Drosophila_2:1626801_at:388:701; Interrogation_Position=837; Antisense; TTACCTGGTTGGTCTGGGTGTCATT
>probe:Drosophila_2:1626801_at:6:533; Interrogation_Position=853; Antisense; GGTGTCATTCCCATTCCAAAGTCAT
>probe:Drosophila_2:1626801_at:591:685; Interrogation_Position=909; Antisense; TATCTTCGATTTTGAGCTGACAGCC
>probe:Drosophila_2:1626801_at:724:227; Interrogation_Position=939; Antisense; AATGGCCGTTCTCGATGGTTATCAC
>probe:Drosophila_2:1626801_at:66:657; Interrogation_Position=996; Antisense; TAAGGGCCTCAACCACAAGTACTAC

Paste this into a BLAST search page for me
CAAGTACTACCCCTTTTCAATTGAGGTTTTAAACCAGATGAGCGCCTTGTGCGCCTTGTTGCTGTATCACGAATAGGTGCGCAGCATCGGAGTATCCAACGTATCCAACTTCAACAGCGAGCAGCGGCTTTGACAGCCTTCTGCAAGAAGTGACGGGCTACACGCCTTTGGGAAAGGACTTTATCTATTCGCCGGAGGTGATATGGCAAGACTACACCGCAGATTTTACCTGGTTGGTCTGGGTGTCATTGGTGTCATTCCCATTCCAAAGTCATTATCTTCGATTTTGAGCTGACAGCCAATGGCCGTTCTCGATGGTTATCACTAAGGGCCTCAACCACAAGTACTAC

Full Affymetrix probeset data:

Annotations for 1626801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720