Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626806_at:

>probe:Drosophila_2:1626806_at:630:421; Interrogation_Position=133; Antisense; GAGCACAAGATTCCGTACTTTGCAG
>probe:Drosophila_2:1626806_at:104:95; Interrogation_Position=238; Antisense; AGATCACAGTCGTCCATCAGAGAGA
>probe:Drosophila_2:1626806_at:565:369; Interrogation_Position=272; Antisense; GAAGGCATCGCCAGCGCTCTAGGAG
>probe:Drosophila_2:1626806_at:691:677; Interrogation_Position=291; Antisense; TAGGAGCCGCAATCGCAACCGAAGT
>probe:Drosophila_2:1626806_at:676:347; Interrogation_Position=32; Antisense; GCAGTGGAACCCAGCATCGAGATTC
>probe:Drosophila_2:1626806_at:329:197; Interrogation_Position=380; Antisense; AACGGAGCCCGCATCGGTATAATCC
>probe:Drosophila_2:1626806_at:313:33; Interrogation_Position=398; Antisense; ATAATCCTCCGCCAAAGATCATCAA
>probe:Drosophila_2:1626806_at:1:193; Interrogation_Position=421; Antisense; AACTACTATGTGCAAGTGCCACCAC
>probe:Drosophila_2:1626806_at:119:313; Interrogation_Position=438; Antisense; GCCACCACAGGATTTCTACGGGATG
>probe:Drosophila_2:1626806_at:103:279; Interrogation_Position=453; Antisense; CTACGGGATGTCTGGTATGCAGCAA
>probe:Drosophila_2:1626806_at:165:729; Interrogation_Position=482; Antisense; TTGGATACCAAAGGCTACCACGTCC
>probe:Drosophila_2:1626806_at:492:95; Interrogation_Position=51; Antisense; AGATTCCCGTGGCTCAAGGTCTCGA
>probe:Drosophila_2:1626806_at:221:123; Interrogation_Position=542; Antisense; AGCGACCGCCGTTCATTGGAGTTCC
>probe:Drosophila_2:1626806_at:494:549; Interrogation_Position=559; Antisense; GGAGTTCCGCGATTTGGCTACAGAA

Paste this into a BLAST search page for me
GAGCACAAGATTCCGTACTTTGCAGAGATCACAGTCGTCCATCAGAGAGAGAAGGCATCGCCAGCGCTCTAGGAGTAGGAGCCGCAATCGCAACCGAAGTGCAGTGGAACCCAGCATCGAGATTCAACGGAGCCCGCATCGGTATAATCCATAATCCTCCGCCAAAGATCATCAAAACTACTATGTGCAAGTGCCACCACGCCACCACAGGATTTCTACGGGATGCTACGGGATGTCTGGTATGCAGCAATTGGATACCAAAGGCTACCACGTCCAGATTCCCGTGGCTCAAGGTCTCGAAGCGACCGCCGTTCATTGGAGTTCCGGAGTTCCGCGATTTGGCTACAGAA

Full Affymetrix probeset data:

Annotations for 1626806_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime