FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626810_at:

>probe:Drosophila_2:1626810_at:585:437; Interrogation_Position=1013; Antisense; GAGGAAGCAGCAGCCGTAGACGTTT
>probe:Drosophila_2:1626810_at:422:261; Interrogation_Position=1023; Antisense; CAGCCGTAGACGTTTATGTATCAGT
>probe:Drosophila_2:1626810_at:336:647; Interrogation_Position=1043; Antisense; TCAGTAGTAGCCGTAGCAGAGCCCC
>probe:Drosophila_2:1626810_at:212:129; Interrogation_Position=1071; Antisense; ACCAGACTTCAAATGCGTTCATCAA
>probe:Drosophila_2:1626810_at:474:473; Interrogation_Position=1087; Antisense; GTTCATCAAAATGGCTAAGCTCCGC
>probe:Drosophila_2:1626810_at:87:433; Interrogation_Position=1165; Antisense; GAGTCCCACTCTCAGAATATTGTGT
>probe:Drosophila_2:1626810_at:354:239; Interrogation_Position=1265; Antisense; AATAAAAGCGAACTGCAGCCAAGTG
>probe:Drosophila_2:1626810_at:319:127; Interrogation_Position=1281; Antisense; AGCCAAGTGGGCATGCGTTCAACAT
>probe:Drosophila_2:1626810_at:416:411; Interrogation_Position=745; Antisense; GACCGGGTCGCAAGAAGGCCGTCAC
>probe:Drosophila_2:1626810_at:483:493; Interrogation_Position=771; Antisense; GTCACGGGTCCCTATGTCGTGTACA
>probe:Drosophila_2:1626810_at:346:61; Interrogation_Position=784; Antisense; ATGTCGTGTACATGCTGCGCGAGGA
>probe:Drosophila_2:1626810_at:543:267; Interrogation_Position=815; Antisense; CATGGAGGACTGGACGATTATACGC
>probe:Drosophila_2:1626810_at:610:405; Interrogation_Position=827; Antisense; GACGATTATACGCAAGGCCCTCAAG
>probe:Drosophila_2:1626810_at:27:487; Interrogation_Position=903; Antisense; GTAAGCGTTAGCCTGTCCGGTTTGC

Paste this into a BLAST search page for me
GAGGAAGCAGCAGCCGTAGACGTTTCAGCCGTAGACGTTTATGTATCAGTTCAGTAGTAGCCGTAGCAGAGCCCCACCAGACTTCAAATGCGTTCATCAAGTTCATCAAAATGGCTAAGCTCCGCGAGTCCCACTCTCAGAATATTGTGTAATAAAAGCGAACTGCAGCCAAGTGAGCCAAGTGGGCATGCGTTCAACATGACCGGGTCGCAAGAAGGCCGTCACGTCACGGGTCCCTATGTCGTGTACAATGTCGTGTACATGCTGCGCGAGGACATGGAGGACTGGACGATTATACGCGACGATTATACGCAAGGCCCTCAAGGTAAGCGTTAGCCTGTCCGGTTTGC

Full Affymetrix probeset data:

Annotations for 1626810_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720