FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626811_at:

>probe:Drosophila_2:1626811_at:134:47; Interrogation_Position=1018; Antisense; ATCCTTCTCTTCGTGGTTGTCGTGG
>probe:Drosophila_2:1626811_at:227:389; Interrogation_Position=1094; Antisense; GAAAACGTTTCTACTGAGCTCTCTA
>probe:Drosophila_2:1626811_at:679:117; Interrogation_Position=1110; Antisense; AGCTCTCTAGCTAGTTCATCACAGT
>probe:Drosophila_2:1626811_at:469:55; Interrogation_Position=1141; Antisense; ATGTTAGGAGTTACCCGGACCTCAG
>probe:Drosophila_2:1626811_at:717:537; Interrogation_Position=1157; Antisense; GGACCTCAGTTGATCGCAACTTTTA
>probe:Drosophila_2:1626811_at:575:17; Interrogation_Position=1187; Antisense; ATTTATACCGCGACTGTATCCCATT
>probe:Drosophila_2:1626811_at:51:685; Interrogation_Position=1203; Antisense; TATCCCATTTCTTATCACCCTTTTT
>probe:Drosophila_2:1626811_at:24:485; Interrogation_Position=781; Antisense; GTAGTGGCCAACGTTGAGCTACCCA
>probe:Drosophila_2:1626811_at:30:675; Interrogation_Position=811; Antisense; TACCACTTCGGCATGTCTGCGACGA
>probe:Drosophila_2:1626811_at:507:409; Interrogation_Position=831; Antisense; GACGACGGGTGATCTGTCCGACAAT
>probe:Drosophila_2:1626811_at:293:89; Interrogation_Position=868; Antisense; AGTTTCAAGTTCTATGACCTGGACT
>probe:Drosophila_2:1626811_at:94:139; Interrogation_Position=905; Antisense; ACGATGAGATTATCCGGCGCTCCAA
>probe:Drosophila_2:1626811_at:306:577; Interrogation_Position=920; Antisense; GGCGCTCCAATATCATACCGAATGC
>probe:Drosophila_2:1626811_at:155:527; Interrogation_Position=990; Antisense; GGGAATGTCCAACGCCAAGATCTTC

Paste this into a BLAST search page for me
ATCCTTCTCTTCGTGGTTGTCGTGGGAAAACGTTTCTACTGAGCTCTCTAAGCTCTCTAGCTAGTTCATCACAGTATGTTAGGAGTTACCCGGACCTCAGGGACCTCAGTTGATCGCAACTTTTAATTTATACCGCGACTGTATCCCATTTATCCCATTTCTTATCACCCTTTTTGTAGTGGCCAACGTTGAGCTACCCATACCACTTCGGCATGTCTGCGACGAGACGACGGGTGATCTGTCCGACAATAGTTTCAAGTTCTATGACCTGGACTACGATGAGATTATCCGGCGCTCCAAGGCGCTCCAATATCATACCGAATGCGGGAATGTCCAACGCCAAGATCTTC

Full Affymetrix probeset data:

Annotations for 1626811_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720