Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626813_at:

>probe:Drosophila_2:1626813_at:179:321; Interrogation_Position=261; Antisense; GCCCGGAACCAGTATCCTTCAAAGT
>probe:Drosophila_2:1626813_at:276:295; Interrogation_Position=328; Antisense; CGAGGGCGCTGTGGTGTCTATTAAC
>probe:Drosophila_2:1626813_at:101:329; Interrogation_Position=369; Antisense; GCGTACTCCGCTATTTGGGCTATGA
>probe:Drosophila_2:1626813_at:524:295; Interrogation_Position=454; Antisense; CGAGCAGTTCCTTATCGCCAAGAAG
>probe:Drosophila_2:1626813_at:554:555; Interrogation_Position=484; Antisense; GGACGAGCAGTTGAGCCGCCCTAAG
>probe:Drosophila_2:1626813_at:259:227; Interrogation_Position=506; Antisense; AAGGCATCCGCTGGTAGTCATTCAA
>probe:Drosophila_2:1626813_at:271:173; Interrogation_Position=529; Antisense; AAAGACTCCCAAGTCATCCAGAAGG
>probe:Drosophila_2:1626813_at:331:89; Interrogation_Position=554; Antisense; AGTAGGATCTCTGGCGGACTGGTTA
>probe:Drosophila_2:1626813_at:604:89; Interrogation_Position=595; Antisense; AGTACCGCCCATGATTGTCGGACAA
>probe:Drosophila_2:1626813_at:57:387; Interrogation_Position=632; Antisense; GAACAGGACTTCGTGGCCATGCTCA
>probe:Drosophila_2:1626813_at:501:303; Interrogation_Position=660; Antisense; CCTGGTACATGTCCGGCTATTATAC
>probe:Drosophila_2:1626813_at:710:687; Interrogation_Position=677; Antisense; TATTATACGGGCCTCTACCAGGGAA
>probe:Drosophila_2:1626813_at:354:211; Interrogation_Position=705; Antisense; AAGAAGCCAGCACCACTAGCGGAAA
>probe:Drosophila_2:1626813_at:573:645; Interrogation_Position=757; Antisense; TCTTATCTCATCATCACATCACATC

Paste this into a BLAST search page for me
GCCCGGAACCAGTATCCTTCAAAGTCGAGGGCGCTGTGGTGTCTATTAACGCGTACTCCGCTATTTGGGCTATGACGAGCAGTTCCTTATCGCCAAGAAGGGACGAGCAGTTGAGCCGCCCTAAGAAGGCATCCGCTGGTAGTCATTCAAAAAGACTCCCAAGTCATCCAGAAGGAGTAGGATCTCTGGCGGACTGGTTAAGTACCGCCCATGATTGTCGGACAAGAACAGGACTTCGTGGCCATGCTCACCTGGTACATGTCCGGCTATTATACTATTATACGGGCCTCTACCAGGGAAAAGAAGCCAGCACCACTAGCGGAAATCTTATCTCATCATCACATCACATC

Full Affymetrix probeset data:

Annotations for 1626813_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime