Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626814_at:

>probe:Drosophila_2:1626814_at:168:639; Interrogation_Position=1728; Antisense; TCTGCAGGAATATCGCCACAAGCTC
>probe:Drosophila_2:1626814_at:179:159; Interrogation_Position=1745; Antisense; ACAAGCTCAAGGCTTCCGGGTCATC
>probe:Drosophila_2:1626814_at:297:383; Interrogation_Position=1774; Antisense; GAACTGCATCCGGACTACAAAGGCT
>probe:Drosophila_2:1626814_at:46:665; Interrogation_Position=1789; Antisense; TACAAAGGCTACTCCTCATCCGGTT
>probe:Drosophila_2:1626814_at:446:475; Interrogation_Position=1811; Antisense; GTTACTTTGCCGAGCCGGAAGCAGA
>probe:Drosophila_2:1626814_at:285:227; Interrogation_Position=1871; Antisense; AAGGCTATCCCTATCATTATGTGCT
>probe:Drosophila_2:1626814_at:570:677; Interrogation_Position=1913; Antisense; TAGATGATCATGAGCCCTGGTTGTC
>probe:Drosophila_2:1626814_at:637:209; Interrogation_Position=2002; Antisense; AAGCACCCGAGTCTTGAATACGACA
>probe:Drosophila_2:1626814_at:466:363; Interrogation_Position=2017; Antisense; GAATACGACAGCTACAGTCCGAAGT
>probe:Drosophila_2:1626814_at:313:91; Interrogation_Position=2039; Antisense; AGTTCAACAACAATCCCGAGGGCTA
>probe:Drosophila_2:1626814_at:512:569; Interrogation_Position=2065; Antisense; GGCTATCAGCACACGTACAAGGTCA
>probe:Drosophila_2:1626814_at:11:331; Interrogation_Position=2186; Antisense; GCGGTCATCCCAGACAAGAGGCGAT
>probe:Drosophila_2:1626814_at:676:209; Interrogation_Position=2215; Antisense; AAGCAACTGCGCTCATCGGAGGTCA
>probe:Drosophila_2:1626814_at:713:201; Interrogation_Position=2249; Antisense; AAGCCAGTTTGGCTCTGAGGCCACC

Paste this into a BLAST search page for me
TCTGCAGGAATATCGCCACAAGCTCACAAGCTCAAGGCTTCCGGGTCATCGAACTGCATCCGGACTACAAAGGCTTACAAAGGCTACTCCTCATCCGGTTGTTACTTTGCCGAGCCGGAAGCAGAAAGGCTATCCCTATCATTATGTGCTTAGATGATCATGAGCCCTGGTTGTCAAGCACCCGAGTCTTGAATACGACAGAATACGACAGCTACAGTCCGAAGTAGTTCAACAACAATCCCGAGGGCTAGGCTATCAGCACACGTACAAGGTCAGCGGTCATCCCAGACAAGAGGCGATAAGCAACTGCGCTCATCGGAGGTCAAAGCCAGTTTGGCTCTGAGGCCACC

Full Affymetrix probeset data:

Annotations for 1626814_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime