FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626817_at:

>probe:Drosophila_2:1626817_at:393:267; Interrogation_Position=1026; Antisense; CAGTGAGACGCCTGTGGCCAACGAA
>probe:Drosophila_2:1626817_at:671:579; Interrogation_Position=1040; Antisense; TGGCCAACGAAGAGCCGTCCAAAGA
>probe:Drosophila_2:1626817_at:162:87; Interrogation_Position=1069; Antisense; AGTGCTGGCGCACCGATGGACACCA
>probe:Drosophila_2:1626817_at:394:407; Interrogation_Position=1096; Antisense; GACTGGCTGCCACACGATGAGGACT
>probe:Drosophila_2:1626817_at:253:443; Interrogation_Position=1111; Antisense; GATGAGGACTCCCAGGAACTGCCCA
>probe:Drosophila_2:1626817_at:330:51; Interrogation_Position=1135; Antisense; ATGCGCTCGGAAGCAAGCCCATCGA
>probe:Drosophila_2:1626817_at:645:171; Interrogation_Position=1209; Antisense; AAAGACACCGCCGAGGAAGCAAAAT
>probe:Drosophila_2:1626817_at:537:379; Interrogation_Position=1252; Antisense; GAAGCCAAGCGATACATCTAGCCGT
>probe:Drosophila_2:1626817_at:184:39; Interrogation_Position=1267; Antisense; ATCTAGCCGTTGTGATAGTCGTGTA
>probe:Drosophila_2:1626817_at:451:485; Interrogation_Position=1336; Antisense; GTATGGCTAAAATCAGTCTAGGCTT
>probe:Drosophila_2:1626817_at:514:197; Interrogation_Position=1402; Antisense; AACCGATGTTCGTCTAAGTTAGGCT
>probe:Drosophila_2:1626817_at:234:277; Interrogation_Position=1439; Antisense; CTAAATATATCTCCAAACCGCCGGG
>probe:Drosophila_2:1626817_at:439:573; Interrogation_Position=905; Antisense; GGCTGGTGGCACTGATTTTAAATAC
>probe:Drosophila_2:1626817_at:123:419; Interrogation_Position=942; Antisense; GAGCTACAACAAACTGATGGGCAGA

Paste this into a BLAST search page for me
CAGTGAGACGCCTGTGGCCAACGAATGGCCAACGAAGAGCCGTCCAAAGAAGTGCTGGCGCACCGATGGACACCAGACTGGCTGCCACACGATGAGGACTGATGAGGACTCCCAGGAACTGCCCAATGCGCTCGGAAGCAAGCCCATCGAAAAGACACCGCCGAGGAAGCAAAATGAAGCCAAGCGATACATCTAGCCGTATCTAGCCGTTGTGATAGTCGTGTAGTATGGCTAAAATCAGTCTAGGCTTAACCGATGTTCGTCTAAGTTAGGCTCTAAATATATCTCCAAACCGCCGGGGGCTGGTGGCACTGATTTTAAATACGAGCTACAACAAACTGATGGGCAGA

Full Affymetrix probeset data:

Annotations for 1626817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720