Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626818_at:

>probe:Drosophila_2:1626818_at:183:337; Interrogation_Position=1992; Antisense; GCTCTGAAGTCCTCAAAGGCTTTCT
>probe:Drosophila_2:1626818_at:274:227; Interrogation_Position=2007; Antisense; AAGGCTTTCTTCCACAAACTGCAGG
>probe:Drosophila_2:1626818_at:489:177; Interrogation_Position=2022; Antisense; AAACTGCAGGATACCGCAGCGGCTA
>probe:Drosophila_2:1626818_at:139:653; Interrogation_Position=2109; Antisense; TAAACGTACACGCTAGGACTCCTTC
>probe:Drosophila_2:1626818_at:485:555; Interrogation_Position=2124; Antisense; GGACTCCTTCATATTGTAATTGCCT
>probe:Drosophila_2:1626818_at:152:205; Interrogation_Position=2150; Antisense; AAGCCAGCAAAGTTTTCTCGTCTCC
>probe:Drosophila_2:1626818_at:354:279; Interrogation_Position=2171; Antisense; CTCCAGTCACGTGCCAGAAAGTTGT
>probe:Drosophila_2:1626818_at:685:467; Interrogation_Position=2191; Antisense; GTTGTCACAAGCACACACGTATGCC
>probe:Drosophila_2:1626818_at:106:683; Interrogation_Position=2210; Antisense; TATGCCCACATAGCAATCCTTGTTG
>probe:Drosophila_2:1626818_at:133:433; Interrogation_Position=2269; Antisense; GAGTCCCCAATTTGGTGCTCCATGG
>probe:Drosophila_2:1626818_at:418:447; Interrogation_Position=2296; Antisense; GATGCCATGTGTCGGTACTTTTAAT
>probe:Drosophila_2:1626818_at:51:669; Interrogation_Position=2311; Antisense; TACTTTTAATGTTCCATGTGCGCGG
>probe:Drosophila_2:1626818_at:298:507; Interrogation_Position=2328; Antisense; GTGCGCGGATCCATCGTATGTGTAT
>probe:Drosophila_2:1626818_at:145:403; Interrogation_Position=2395; Antisense; GACATTCTGTGTCCTGTTGAGGCGA

Paste this into a BLAST search page for me
GCTCTGAAGTCCTCAAAGGCTTTCTAAGGCTTTCTTCCACAAACTGCAGGAAACTGCAGGATACCGCAGCGGCTATAAACGTACACGCTAGGACTCCTTCGGACTCCTTCATATTGTAATTGCCTAAGCCAGCAAAGTTTTCTCGTCTCCCTCCAGTCACGTGCCAGAAAGTTGTGTTGTCACAAGCACACACGTATGCCTATGCCCACATAGCAATCCTTGTTGGAGTCCCCAATTTGGTGCTCCATGGGATGCCATGTGTCGGTACTTTTAATTACTTTTAATGTTCCATGTGCGCGGGTGCGCGGATCCATCGTATGTGTATGACATTCTGTGTCCTGTTGAGGCGA

Full Affymetrix probeset data:

Annotations for 1626818_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime