Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626819_s_at:

>probe:Drosophila_2:1626819_s_at:142:473; Interrogation_Position=384; Antisense; GTTCATGGGCCTAAATCTGCTCTAT
>probe:Drosophila_2:1626819_s_at:211:643; Interrogation_Position=399; Antisense; TCTGCTCTATATGTTGGCTACCAAT
>probe:Drosophila_2:1626819_s_at:168:383; Interrogation_Position=445; Antisense; GAACTGGAACGTTTGCCGACGGCTT
>probe:Drosophila_2:1626819_s_at:17:143; Interrogation_Position=463; Antisense; ACGGCTTTGCTGCTCCATGATAGCT
>probe:Drosophila_2:1626819_s_at:311:59; Interrogation_Position=479; Antisense; ATGATAGCTTCATCCAACCCGTTTT
>probe:Drosophila_2:1626819_s_at:626:395; Interrogation_Position=558; Antisense; GAAATCTATGCCCTCGGAGATCTAT
>probe:Drosophila_2:1626819_s_at:479:235; Interrogation_Position=644; Antisense; AATCCTATCTGAAGATGGCGCCCAA
>probe:Drosophila_2:1626819_s_at:65:675; Interrogation_Position=671; Antisense; TAGCTGCTCAGCGTTTAGGCCTTCG
>probe:Drosophila_2:1626819_s_at:148:385; Interrogation_Position=759; Antisense; GAACTACGACTATGCTGGACTTCAT
>probe:Drosophila_2:1626819_s_at:101:587; Interrogation_Position=774; Antisense; TGGACTTCATACCAGACCTATGGAG
>probe:Drosophila_2:1626819_s_at:291:423; Interrogation_Position=796; Antisense; GAGAAGGTTCCTGCCAAGGACATCG
>probe:Drosophila_2:1626819_s_at:637:225; Interrogation_Position=811; Antisense; AAGGACATCGCCACGCATAATCTCA
>probe:Drosophila_2:1626819_s_at:622:655; Interrogation_Position=828; Antisense; TAATCTCACCTATGCCCAAGAGCTA
>probe:Drosophila_2:1626819_s_at:342:97; Interrogation_Position=879; Antisense; AGATCAATTCTTGCTTCTAATCCCC

Paste this into a BLAST search page for me
GTTCATGGGCCTAAATCTGCTCTATTCTGCTCTATATGTTGGCTACCAATGAACTGGAACGTTTGCCGACGGCTTACGGCTTTGCTGCTCCATGATAGCTATGATAGCTTCATCCAACCCGTTTTGAAATCTATGCCCTCGGAGATCTATAATCCTATCTGAAGATGGCGCCCAATAGCTGCTCAGCGTTTAGGCCTTCGGAACTACGACTATGCTGGACTTCATTGGACTTCATACCAGACCTATGGAGGAGAAGGTTCCTGCCAAGGACATCGAAGGACATCGCCACGCATAATCTCATAATCTCACCTATGCCCAAGAGCTAAGATCAATTCTTGCTTCTAATCCCC

Full Affymetrix probeset data:

Annotations for 1626819_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime