Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626826_s_at:

>probe:Drosophila_2:1626826_s_at:553:57; Interrogation_Position=102; Antisense; ATGATCCACGAGTCGGAGGCGTCCA
>probe:Drosophila_2:1626826_s_at:404:431; Interrogation_Position=111; Antisense; GAGTCGGAGGCGTCCACAACCACCA
>probe:Drosophila_2:1626826_s_at:713:485; Interrogation_Position=18; Antisense; GTAGCAAGGCATCTATTGTAGCATT
>probe:Drosophila_2:1626826_s_at:2:651; Interrogation_Position=243; Antisense; TCACCTTCCTCGAGCTCAAAAAAGA
>probe:Drosophila_2:1626826_s_at:317:375; Interrogation_Position=266; Antisense; GAAGACTGTCACTCACTATAAGCGA
>probe:Drosophila_2:1626826_s_at:146:495; Interrogation_Position=273; Antisense; GTCACTCACTATAAGCGAAAGGTCA
>probe:Drosophila_2:1626826_s_at:176:31; Interrogation_Position=283; Antisense; ATAAGCGAAAGGTCAAGAGGCCAAA
>probe:Drosophila_2:1626826_s_at:634:577; Interrogation_Position=301; Antisense; GGCCAAAGAAGGTCAGGAAAATCAC
>probe:Drosophila_2:1626826_s_at:356:3; Interrogation_Position=32; Antisense; ATTGTAGCATTTGCTCACCATGAAG
>probe:Drosophila_2:1626826_s_at:643:497; Interrogation_Position=337; Antisense; GTCTCAGGAGCCGCAATGGTCGCAG
>probe:Drosophila_2:1626826_s_at:678:337; Interrogation_Position=44; Antisense; GCTCACCATGAAGATCACCGTGGTA
>probe:Drosophila_2:1626826_s_at:142:375; Interrogation_Position=53; Antisense; GAAGATCACCGTGGTACTCGTACTT
>probe:Drosophila_2:1626826_s_at:507:589; Interrogation_Position=64; Antisense; TGGTACTCGTACTTCTCGCCACCTT
>probe:Drosophila_2:1626826_s_at:212:631; Interrogation_Position=88; Antisense; TCCTCGGCTGTGTGATGATCCACGA

Paste this into a BLAST search page for me
ATGATCCACGAGTCGGAGGCGTCCAGAGTCGGAGGCGTCCACAACCACCAGTAGCAAGGCATCTATTGTAGCATTTCACCTTCCTCGAGCTCAAAAAAGAGAAGACTGTCACTCACTATAAGCGAGTCACTCACTATAAGCGAAAGGTCAATAAGCGAAAGGTCAAGAGGCCAAAGGCCAAAGAAGGTCAGGAAAATCACATTGTAGCATTTGCTCACCATGAAGGTCTCAGGAGCCGCAATGGTCGCAGGCTCACCATGAAGATCACCGTGGTAGAAGATCACCGTGGTACTCGTACTTTGGTACTCGTACTTCTCGCCACCTTTCCTCGGCTGTGTGATGATCCACGA

Full Affymetrix probeset data:

Annotations for 1626826_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime