Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626829_s_at:

>probe:Drosophila_2:1626829_s_at:456:239; Interrogation_Position=259; Antisense; AATCAGCGAGGTGCCCATGGAGGTA
>probe:Drosophila_2:1626829_s_at:429:481; Interrogation_Position=281; Antisense; GTATTCGAGGCAGCTCAGCAGGAGC
>probe:Drosophila_2:1626829_s_at:461:239; Interrogation_Position=311; Antisense; AATATCGTGAGCTTGGATGGCAACA
>probe:Drosophila_2:1626829_s_at:70:359; Interrogation_Position=330; Antisense; GCAACAGGTTGCTCGAGATGCCCAA
>probe:Drosophila_2:1626829_s_at:678:97; Interrogation_Position=345; Antisense; AGATGCCCAAAGATCTGCCCTTGCT
>probe:Drosophila_2:1626829_s_at:571:279; Interrogation_Position=380; Antisense; CTCACCCAGTTGGTCCTGAACAAAA
>probe:Drosophila_2:1626829_s_at:77:129; Interrogation_Position=425; Antisense; ACCAACATCTCGCAGTACTCGAAGT
>probe:Drosophila_2:1626829_s_at:49:637; Interrogation_Position=443; Antisense; TCGAAGTTGACTAACCTGAGCCTCT
>probe:Drosophila_2:1626829_s_at:47:629; Interrogation_Position=467; Antisense; TCCAACAATCTTCTGTGCGACTTGC
>probe:Drosophila_2:1626829_s_at:62:629; Interrogation_Position=558; Antisense; TGCCACGCTGCATCTACGAGCTAGA
>probe:Drosophila_2:1626829_s_at:148:101; Interrogation_Position=582; Antisense; AGAGACTGGAAACCTTGTCGGCCCA
>probe:Drosophila_2:1626829_s_at:478:449; Interrogation_Position=616; Antisense; GATCCGTGCCATCGATGCTAGTGAA
>probe:Drosophila_2:1626829_s_at:507:231; Interrogation_Position=689; Antisense; AATGACATCCAAATAGTGCCGCCGA
>probe:Drosophila_2:1626829_s_at:180:679; Interrogation_Position=702; Antisense; TAGTGCCGCCGATCTTGGGCAAAAT

Paste this into a BLAST search page for me
AATCAGCGAGGTGCCCATGGAGGTAGTATTCGAGGCAGCTCAGCAGGAGCAATATCGTGAGCTTGGATGGCAACAGCAACAGGTTGCTCGAGATGCCCAAAGATGCCCAAAGATCTGCCCTTGCTCTCACCCAGTTGGTCCTGAACAAAAACCAACATCTCGCAGTACTCGAAGTTCGAAGTTGACTAACCTGAGCCTCTTCCAACAATCTTCTGTGCGACTTGCTGCCACGCTGCATCTACGAGCTAGAAGAGACTGGAAACCTTGTCGGCCCAGATCCGTGCCATCGATGCTAGTGAAAATGACATCCAAATAGTGCCGCCGATAGTGCCGCCGATCTTGGGCAAAAT

Full Affymetrix probeset data:

Annotations for 1626829_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime