FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626830_at:

>probe:Drosophila_2:1626830_at:270:7; Interrogation_Position=108; Antisense; ATTCCCTAGGCCGTTCGGAGGATGT
>probe:Drosophila_2:1626830_at:481:549; Interrogation_Position=124; Antisense; GGAGGATGTCCACGCCGATGTCCTT
>probe:Drosophila_2:1626830_at:203:61; Interrogation_Position=141; Antisense; ATGTCCTTTCCCAATCCGATGATGT
>probe:Drosophila_2:1626830_at:622:235; Interrogation_Position=153; Antisense; AATCCGATGATGTTCGTGCCGATGG
>probe:Drosophila_2:1626830_at:296:443; Interrogation_Position=161; Antisense; GATGTTCGTGCCGATGGATTCGATT
>probe:Drosophila_2:1626830_at:86:85; Interrogation_Position=286; Antisense; CGTCGAGGTTAAGTACGTCGCCAAT
>probe:Drosophila_2:1626830_at:90:659; Interrogation_Position=295; Antisense; TAAGTACGTCGCCAATGAGAACGGA
>probe:Drosophila_2:1626830_at:615:299; Interrogation_Position=423; Antisense; CCCGTCATCACTAGAACCTCTATGA
>probe:Drosophila_2:1626830_at:241:381; Interrogation_Position=436; Antisense; GAACCTCTATGAAAGCGGATCGCAC
>probe:Drosophila_2:1626830_at:231:45; Interrogation_Position=454; Antisense; ATCGCACTACGGACTGTTCCCCGAA
>probe:Drosophila_2:1626830_at:531:373; Interrogation_Position=476; Antisense; GAAGACCTTTCGAACTATTAGCTTA
>probe:Drosophila_2:1626830_at:327:667; Interrogation_Position=494; Antisense; TAGCTTAAGTAATCGTACTGTTTGT
>probe:Drosophila_2:1626830_at:329:217; Interrogation_Position=50; Antisense; AAGTTTGTCATGATCTGCGCAGTTT
>probe:Drosophila_2:1626830_at:553:27; Interrogation_Position=522; Antisense; ATACACGCAATTGTTAACGGCAGAA

Paste this into a BLAST search page for me
ATTCCCTAGGCCGTTCGGAGGATGTGGAGGATGTCCACGCCGATGTCCTTATGTCCTTTCCCAATCCGATGATGTAATCCGATGATGTTCGTGCCGATGGGATGTTCGTGCCGATGGATTCGATTCGTCGAGGTTAAGTACGTCGCCAATTAAGTACGTCGCCAATGAGAACGGACCCGTCATCACTAGAACCTCTATGAGAACCTCTATGAAAGCGGATCGCACATCGCACTACGGACTGTTCCCCGAAGAAGACCTTTCGAACTATTAGCTTATAGCTTAAGTAATCGTACTGTTTGTAAGTTTGTCATGATCTGCGCAGTTTATACACGCAATTGTTAACGGCAGAA

Full Affymetrix probeset data:

Annotations for 1626830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720