FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626831_at:

>probe:Drosophila_2:1626831_at:73:187; Interrogation_Position=308; Antisense; AACAAGTGATTTTCGTGCTCCTCAT
>probe:Drosophila_2:1626831_at:416:267; Interrogation_Position=351; Antisense; CAGTGCATCGGCCATCAAGTGTTAT
>probe:Drosophila_2:1626831_at:677:601; Interrogation_Position=370; Antisense; TGTTATCAGTGCAAATCCCTCACGG
>probe:Drosophila_2:1626831_at:314:559; Interrogation_Position=411; Antisense; GGACAAGATCGATTCTGCCTCTAAC
>probe:Drosophila_2:1626831_at:22:519; Interrogation_Position=445; Antisense; GTGGATTGCGACAGTGTGCCCAAGC
>probe:Drosophila_2:1626831_at:373:195; Interrogation_Position=485; Antisense; AACTGCAGCCAGTGACCAGGTGCAA
>probe:Drosophila_2:1626831_at:636:121; Interrogation_Position=523; Antisense; AGCGACCGCGCTGGAACGATTGTGT
>probe:Drosophila_2:1626831_at:730:311; Interrogation_Position=557; Antisense; GCCACTTCGAGTCCATCGGGCAGAA
>probe:Drosophila_2:1626831_at:538:73; Interrogation_Position=581; Antisense; AGGACAACGAATGCACGGTGACCCA
>probe:Drosophila_2:1626831_at:303:519; Interrogation_Position=616; Antisense; GTGGAGAGCTGCTACACCTGCAAGG
>probe:Drosophila_2:1626831_at:372:223; Interrogation_Position=637; Antisense; AAGGGTGACCTGTGCAACGCATCCG
>probe:Drosophila_2:1626831_at:286:693; Interrogation_Position=673; Antisense; TTTGTGGCGGTCAGTGCAACGGCTC
>probe:Drosophila_2:1626831_at:91:653; Interrogation_Position=716; Antisense; TCAACTTGAGCCTGTGATGCCGCAC
>probe:Drosophila_2:1626831_at:651:235; Interrogation_Position=743; Antisense; AATCCGGTCCAGAAATGCATTAAAT

Paste this into a BLAST search page for me
AACAAGTGATTTTCGTGCTCCTCATCAGTGCATCGGCCATCAAGTGTTATTGTTATCAGTGCAAATCCCTCACGGGGACAAGATCGATTCTGCCTCTAACGTGGATTGCGACAGTGTGCCCAAGCAACTGCAGCCAGTGACCAGGTGCAAAGCGACCGCGCTGGAACGATTGTGTGCCACTTCGAGTCCATCGGGCAGAAAGGACAACGAATGCACGGTGACCCAGTGGAGAGCTGCTACACCTGCAAGGAAGGGTGACCTGTGCAACGCATCCGTTTGTGGCGGTCAGTGCAACGGCTCTCAACTTGAGCCTGTGATGCCGCACAATCCGGTCCAGAAATGCATTAAAT

Full Affymetrix probeset data:

Annotations for 1626831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720