FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626832_at:

>probe:Drosophila_2:1626832_at:554:415; Interrogation_Position=2457; Antisense; GAGCCAGCTGCTTGATTTCTTGAGA
>probe:Drosophila_2:1626832_at:221:19; Interrogation_Position=2471; Antisense; ATTTCTTGAGACTATCCCTGGACAC
>probe:Drosophila_2:1626832_at:229:27; Interrogation_Position=2501; Antisense; ATAGCTTGAGCTACTCGGAGCGCAC
>probe:Drosophila_2:1626832_at:323:579; Interrogation_Position=2541; Antisense; GGCCTATTCCCGCAGTGAAATCGGT
>probe:Drosophila_2:1626832_at:63:637; Interrogation_Position=2561; Antisense; TCGGTCTTACCGCTAGTTTGGAATT
>probe:Drosophila_2:1626832_at:440:439; Interrogation_Position=2602; Antisense; GAGGCATATGCCAACCTTTCAGACT
>probe:Drosophila_2:1626832_at:341:713; Interrogation_Position=2619; Antisense; TTCAGACTCTGCAAAGCCCCTGGAT
>probe:Drosophila_2:1626832_at:46:105; Interrogation_Position=2690; Antisense; AGACGAGGCTTAACGCTTTGGTGGA
>probe:Drosophila_2:1626832_at:704:605; Interrogation_Position=2748; Antisense; TGATGATCTGAGCACCACCATTGAC
>probe:Drosophila_2:1626832_at:602:365; Interrogation_Position=2777; Antisense; GAATCACATCCAACTTCGCTTGGTT
>probe:Drosophila_2:1626832_at:508:473; Interrogation_Position=2806; Antisense; GTTAATCGTGATCCAGTGCTCAACT
>probe:Drosophila_2:1626832_at:712:505; Interrogation_Position=2821; Antisense; GTGCTCAACTGGATCGAGGATTCCT
>probe:Drosophila_2:1626832_at:381:137; Interrogation_Position=2887; Antisense; ACGATCCTGGTCAGTGCGATGGCTC
>probe:Drosophila_2:1626832_at:291:441; Interrogation_Position=2904; Antisense; GATGGCTCTGTTGCTATTCAGGCTA

Paste this into a BLAST search page for me
GAGCCAGCTGCTTGATTTCTTGAGAATTTCTTGAGACTATCCCTGGACACATAGCTTGAGCTACTCGGAGCGCACGGCCTATTCCCGCAGTGAAATCGGTTCGGTCTTACCGCTAGTTTGGAATTGAGGCATATGCCAACCTTTCAGACTTTCAGACTCTGCAAAGCCCCTGGATAGACGAGGCTTAACGCTTTGGTGGATGATGATCTGAGCACCACCATTGACGAATCACATCCAACTTCGCTTGGTTGTTAATCGTGATCCAGTGCTCAACTGTGCTCAACTGGATCGAGGATTCCTACGATCCTGGTCAGTGCGATGGCTCGATGGCTCTGTTGCTATTCAGGCTA

Full Affymetrix probeset data:

Annotations for 1626832_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720