FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626833_at:

>probe:Drosophila_2:1626833_at:673:381; Interrogation_Position=198; Antisense; GAACGTCGATCAGGCTAAGCAGAAT
>probe:Drosophila_2:1626833_at:185:655; Interrogation_Position=222; Antisense; TAAGGTGGAGAAACCCGTCACCACT
>probe:Drosophila_2:1626833_at:38:669; Interrogation_Position=246; Antisense; TACTGCACCCAAGGATCCTACGGGT
>probe:Drosophila_2:1626833_at:313:209; Interrogation_Position=280; Antisense; AAGACTTCAGCTCCTGCCAAAAACT
>probe:Drosophila_2:1626833_at:656:181; Interrogation_Position=299; Antisense; AAAACTCCAGCACACTGCCAGATAA
>probe:Drosophila_2:1626833_at:65:663; Interrogation_Position=321; Antisense; TAAAACTCCACAGAGCAGCCAGGAA
>probe:Drosophila_2:1626833_at:599:47; Interrogation_Position=350; Antisense; ATCCTCCCCTCATTCAAGAGAAAAC
>probe:Drosophila_2:1626833_at:130:167; Interrogation_Position=384; Antisense; AAATGCGAGCAGCAAGCCTGAGAAT
>probe:Drosophila_2:1626833_at:353:55; Interrogation_Position=407; Antisense; ATGAAACTACTGTCGAGAAACTGCC
>probe:Drosophila_2:1626833_at:46:175; Interrogation_Position=454; Antisense; AAGACCAATAAATCGGAGGCCGCTC
>probe:Drosophila_2:1626833_at:692:651; Interrogation_Position=518; Antisense; TCAAGCGGGCGGACACGGAATCCAG
>probe:Drosophila_2:1626833_at:84:235; Interrogation_Position=536; Antisense; AATCCAGTGAAATTGTGGCCGACGA
>probe:Drosophila_2:1626833_at:552:557; Interrogation_Position=567; Antisense; GGACATCAATCTCAAGCGACACATC
>probe:Drosophila_2:1626833_at:439:435; Interrogation_Position=694; Antisense; GAGGTCGATCCGGAATTGAGTTCAA

Paste this into a BLAST search page for me
GAACGTCGATCAGGCTAAGCAGAATTAAGGTGGAGAAACCCGTCACCACTTACTGCACCCAAGGATCCTACGGGTAAGACTTCAGCTCCTGCCAAAAACTAAAACTCCAGCACACTGCCAGATAATAAAACTCCACAGAGCAGCCAGGAAATCCTCCCCTCATTCAAGAGAAAACAAATGCGAGCAGCAAGCCTGAGAATATGAAACTACTGTCGAGAAACTGCCAAGACCAATAAATCGGAGGCCGCTCTCAAGCGGGCGGACACGGAATCCAGAATCCAGTGAAATTGTGGCCGACGAGGACATCAATCTCAAGCGACACATCGAGGTCGATCCGGAATTGAGTTCAA

Full Affymetrix probeset data:

Annotations for 1626833_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720