Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626834_at:

>probe:Drosophila_2:1626834_at:231:175; Interrogation_Position=1013; Antisense; AAACCTAATTTTCTATGCGCAACAA
>probe:Drosophila_2:1626834_at:577:715; Interrogation_Position=439; Antisense; TTCTGGAGCTTGTACCATACCATCA
>probe:Drosophila_2:1626834_at:394:445; Interrogation_Position=488; Antisense; GATGCGATTACTCCGTGTTCAAGAA
>probe:Drosophila_2:1626834_at:703:253; Interrogation_Position=543; Antisense; CAACATCAAGGGTGGTCGCTGGCTG
>probe:Drosophila_2:1626834_at:323:503; Interrogation_Position=557; Antisense; GTCGCTGGCTGGTCACCGTGAGTAA
>probe:Drosophila_2:1626834_at:141:243; Interrogation_Position=606; Antisense; AATTTGGCTGGACATTCTACTGCTG
>probe:Drosophila_2:1626834_at:532:11; Interrogation_Position=619; Antisense; ATTCTACTGCTGATGGTGGGCCAAA
>probe:Drosophila_2:1626834_at:545:427; Interrogation_Position=661; Antisense; GAGATCTGCGGAGCTGTCATCAATA
>probe:Drosophila_2:1626834_at:569:255; Interrogation_Position=702; Antisense; CAAAATCTCGGTTTGGACTGCCAAC
>probe:Drosophila_2:1626834_at:110:351; Interrogation_Position=801; Antisense; GCAGTATCAACTTCATTCCGATGCA
>probe:Drosophila_2:1626834_at:419:1; Interrogation_Position=837; Antisense; CAATTCGGGCGTCAAATCGGTTTAT
>probe:Drosophila_2:1626834_at:565:39; Interrogation_Position=852; Antisense; ATCGGTTTATACACTCTGAAAGCGA
>probe:Drosophila_2:1626834_at:721:391; Interrogation_Position=869; Antisense; GAAAGCGATTGTTTAGGTCCTCTAC
>probe:Drosophila_2:1626834_at:396:21; Interrogation_Position=964; Antisense; ATATTTACTTGGAATTGCCCCTACA

Paste this into a BLAST search page for me
AAACCTAATTTTCTATGCGCAACAATTCTGGAGCTTGTACCATACCATCAGATGCGATTACTCCGTGTTCAAGAACAACATCAAGGGTGGTCGCTGGCTGGTCGCTGGCTGGTCACCGTGAGTAAAATTTGGCTGGACATTCTACTGCTGATTCTACTGCTGATGGTGGGCCAAAGAGATCTGCGGAGCTGTCATCAATACAAAATCTCGGTTTGGACTGCCAACGCAGTATCAACTTCATTCCGATGCACAATTCGGGCGTCAAATCGGTTTATATCGGTTTATACACTCTGAAAGCGAGAAAGCGATTGTTTAGGTCCTCTACATATTTACTTGGAATTGCCCCTACA

Full Affymetrix probeset data:

Annotations for 1626834_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime