FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626835_at:

>probe:Drosophila_2:1626835_at:91:1; Interrogation_Position=185; Antisense; CCAACAACAACGATTTTCCCATACT
>probe:Drosophila_2:1626835_at:516:319; Interrogation_Position=219; Antisense; GCCGAACGCGAATGACAACTACAAT
>probe:Drosophila_2:1626835_at:660:389; Interrogation_Position=232; Antisense; GACAACTACAATCAATTCGGTGACC
>probe:Drosophila_2:1626835_at:695:279; Interrogation_Position=237; Antisense; CTACAATCAATTCGGTGACCATCAA
>probe:Drosophila_2:1626835_at:617:715; Interrogation_Position=247; Antisense; TTCGGTGACCATCAAATCAGGAACA
>probe:Drosophila_2:1626835_at:552:271; Interrogation_Position=522; Antisense; CATCGTTCTGGTGTCGCTTTTCAAT
>probe:Drosophila_2:1626835_at:433:471; Interrogation_Position=526; Antisense; GTTCTGGTGTCGCTTTTCAATTGAT
>probe:Drosophila_2:1626835_at:628:533; Interrogation_Position=531; Antisense; GGTGTCGCTTTTCAATTGATACAAT
>probe:Drosophila_2:1626835_at:379:247; Interrogation_Position=552; Antisense; CAATTAAACACACACTCACAGAAAA
>probe:Drosophila_2:1626835_at:122:165; Interrogation_Position=596; Antisense; AAATCATGTAATTCCGTTTCCCAAT
>probe:Drosophila_2:1626835_at:62:647; Interrogation_Position=599; Antisense; TCATGTAATTCCGTTTCCCAATCAG
>probe:Drosophila_2:1626835_at:545:599; Interrogation_Position=602; Antisense; TGTAATTCCGTTTCCCAATCAGCAA
>probe:Drosophila_2:1626835_at:101:235; Interrogation_Position=605; Antisense; AATTCCGTTTCCCAATCAGCAAAGT
>probe:Drosophila_2:1626835_at:653:693; Interrogation_Position=607; Antisense; TTCCGTTTCCCAATCAGCAAAGTTA

Paste this into a BLAST search page for me
CCAACAACAACGATTTTCCCATACTGCCGAACGCGAATGACAACTACAATGACAACTACAATCAATTCGGTGACCCTACAATCAATTCGGTGACCATCAATTCGGTGACCATCAAATCAGGAACACATCGTTCTGGTGTCGCTTTTCAATGTTCTGGTGTCGCTTTTCAATTGATGGTGTCGCTTTTCAATTGATACAATCAATTAAACACACACTCACAGAAAAAAATCATGTAATTCCGTTTCCCAATTCATGTAATTCCGTTTCCCAATCAGTGTAATTCCGTTTCCCAATCAGCAAAATTCCGTTTCCCAATCAGCAAAGTTTCCGTTTCCCAATCAGCAAAGTTA

Full Affymetrix probeset data:

Annotations for 1626835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720