FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626836_at:

>probe:Drosophila_2:1626836_at:176:189; Interrogation_Position=425; Antisense; AACAGCTCCTTCAGCAACATGTGGC
>probe:Drosophila_2:1626836_at:362:359; Interrogation_Position=438; Antisense; GCAACATGTGGCCAACAGTTCACCA
>probe:Drosophila_2:1626836_at:374:473; Interrogation_Position=455; Antisense; GTTCACCACTGCAACATCTGAGCAA
>probe:Drosophila_2:1626836_at:215:39; Interrogation_Position=470; Antisense; ATCTGAGCAATCTGTTTGGCCAACA
>probe:Drosophila_2:1626836_at:434:617; Interrogation_Position=512; Antisense; TGCAGCACTTGATTGCCGCCGAGTA
>probe:Drosophila_2:1626836_at:103:207; Interrogation_Position=576; Antisense; AAGCGAGCCAACAACTCAATCAGTG
>probe:Drosophila_2:1626836_at:104:111; Interrogation_Position=603; Antisense; AGCAACATCGGTCTTTAGCTTCACG
>probe:Drosophila_2:1626836_at:507:187; Interrogation_Position=635; Antisense; AACACGTCAATTTTGCCGCCTCATT
>probe:Drosophila_2:1626836_at:26:301; Interrogation_Position=651; Antisense; CGCCTCATTAGTCGCATTACAGCAA
>probe:Drosophila_2:1626836_at:543:167; Interrogation_Position=675; Antisense; AAATGATGCCTTGCCCGAGGAAACA
>probe:Drosophila_2:1626836_at:177:397; Interrogation_Position=732; Antisense; GACAACTGCATCAGGAGCGGCAACT
>probe:Drosophila_2:1626836_at:354:725; Interrogation_Position=796; Antisense; TTGAAGGCGCCAACAGCAACACAGG
>probe:Drosophila_2:1626836_at:540:267; Interrogation_Position=817; Antisense; CAGGCGGCAGCAACAATGGACGACA
>probe:Drosophila_2:1626836_at:376:197; Interrogation_Position=868; Antisense; AACGGCGGCCACATGCAAAATGCAG

Paste this into a BLAST search page for me
AACAGCTCCTTCAGCAACATGTGGCGCAACATGTGGCCAACAGTTCACCAGTTCACCACTGCAACATCTGAGCAAATCTGAGCAATCTGTTTGGCCAACATGCAGCACTTGATTGCCGCCGAGTAAAGCGAGCCAACAACTCAATCAGTGAGCAACATCGGTCTTTAGCTTCACGAACACGTCAATTTTGCCGCCTCATTCGCCTCATTAGTCGCATTACAGCAAAAATGATGCCTTGCCCGAGGAAACAGACAACTGCATCAGGAGCGGCAACTTTGAAGGCGCCAACAGCAACACAGGCAGGCGGCAGCAACAATGGACGACAAACGGCGGCCACATGCAAAATGCAG

Full Affymetrix probeset data:

Annotations for 1626836_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720