FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626844_at:

>probe:Drosophila_2:1626844_at:699:383; Interrogation_Position=2191; Antisense; GAACTGATTTCCTATCAGCCCATGT
>probe:Drosophila_2:1626844_at:622:123; Interrogation_Position=2207; Antisense; AGCCCATGTATGATCTGTCCGACAT
>probe:Drosophila_2:1626844_at:138:17; Interrogation_Position=2230; Antisense; ATTTTGGACACGGACGATGGCAACA
>probe:Drosophila_2:1626844_at:184:445; Interrogation_Position=2280; Antisense; GATGCAGACGCAAAGTTCGGTTTTA
>probe:Drosophila_2:1626844_at:141:165; Interrogation_Position=2304; Antisense; AAATACGCCACGTCACGAGTTGTAA
>probe:Drosophila_2:1626844_at:196:487; Interrogation_Position=2339; Antisense; GTAGCAGCAGCTCAGCCGTTAAATT
>probe:Drosophila_2:1626844_at:627:255; Interrogation_Position=2403; Antisense; CACGTTAATTTTCATCACCTACTCT
>probe:Drosophila_2:1626844_at:612:261; Interrogation_Position=2418; Antisense; CACCTACTCTGTCTAACCATTTAGT
>probe:Drosophila_2:1626844_at:515:231; Interrogation_Position=2486; Antisense; AATGATCTGTATATGCCTTATGCAC
>probe:Drosophila_2:1626844_at:718:483; Interrogation_Position=2588; Antisense; GTATCGCGGGATTTTGCGGGCCCCA
>probe:Drosophila_2:1626844_at:645:523; Interrogation_Position=2605; Antisense; GGGCCCCAGCTCAGCAGGTAGAAGA
>probe:Drosophila_2:1626844_at:65:511; Interrogation_Position=2662; Antisense; GTGAAAGCTGATCGCATCGTATACG
>probe:Drosophila_2:1626844_at:44:451; Interrogation_Position=2693; Antisense; GATCGCACGCTTCAGTTTATACATT
>probe:Drosophila_2:1626844_at:40:477; Interrogation_Position=2754; Antisense; GTTTAATGTCGCGTTGAGCTGCAAA

Paste this into a BLAST search page for me
GAACTGATTTCCTATCAGCCCATGTAGCCCATGTATGATCTGTCCGACATATTTTGGACACGGACGATGGCAACAGATGCAGACGCAAAGTTCGGTTTTAAAATACGCCACGTCACGAGTTGTAAGTAGCAGCAGCTCAGCCGTTAAATTCACGTTAATTTTCATCACCTACTCTCACCTACTCTGTCTAACCATTTAGTAATGATCTGTATATGCCTTATGCACGTATCGCGGGATTTTGCGGGCCCCAGGGCCCCAGCTCAGCAGGTAGAAGAGTGAAAGCTGATCGCATCGTATACGGATCGCACGCTTCAGTTTATACATTGTTTAATGTCGCGTTGAGCTGCAAA

Full Affymetrix probeset data:

Annotations for 1626844_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720