FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626845_at:

>probe:Drosophila_2:1626845_at:246:11; Interrogation_Position=1402; Antisense; ATTCGCGCACCATTGCCGGTAAGGA
>probe:Drosophila_2:1626845_at:656:45; Interrogation_Position=1446; Antisense; ATCGCCAAGGGCCTGGAGATCATTC
>probe:Drosophila_2:1626845_at:650:119; Interrogation_Position=1477; Antisense; AGCTGTGCGACAACGCCGGTTTCGA
>probe:Drosophila_2:1626845_at:646:49; Interrogation_Position=1501; Antisense; ATGCCACCAACATTCTCAACAAGTT
>probe:Drosophila_2:1626845_at:606:517; Interrogation_Position=1553; Antisense; GTGGTACGGCGTCGACATCAACAAG
>probe:Drosophila_2:1626845_at:449:527; Interrogation_Position=1612; Antisense; GGGAGCCGTCCATCATTAAGATCAA
>probe:Drosophila_2:1626845_at:495:215; Interrogation_Position=1629; Antisense; AAGATCAATGCACTGACGGCGGCCG
>probe:Drosophila_2:1626845_at:466:57; Interrogation_Position=1668; Antisense; ATGATCCTTTCCGTCGATGAGACAA
>probe:Drosophila_2:1626845_at:335:395; Interrogation_Position=1786; Antisense; GAAATCCAGAGAACACTACACCCTA
>probe:Drosophila_2:1626845_at:425:663; Interrogation_Position=1802; Antisense; TACACCCTAATCATCAAAACTCACT
>probe:Drosophila_2:1626845_at:219:257; Interrogation_Position=1823; Antisense; CACTTGCATTTCTCTCCTAATTTAA
>probe:Drosophila_2:1626845_at:203:475; Interrogation_Position=1857; Antisense; GTATTACTCGGTCATACCTTCGCAT
>probe:Drosophila_2:1626845_at:165:345; Interrogation_Position=1878; Antisense; GCATTTCGCACGCTTCGAAGCAAGA
>probe:Drosophila_2:1626845_at:709:655; Interrogation_Position=1916; Antisense; TAATCCACTGACCTATCTGTATATG

Paste this into a BLAST search page for me
ATTCGCGCACCATTGCCGGTAAGGAATCGCCAAGGGCCTGGAGATCATTCAGCTGTGCGACAACGCCGGTTTCGAATGCCACCAACATTCTCAACAAGTTGTGGTACGGCGTCGACATCAACAAGGGGAGCCGTCCATCATTAAGATCAAAAGATCAATGCACTGACGGCGGCCGATGATCCTTTCCGTCGATGAGACAAGAAATCCAGAGAACACTACACCCTATACACCCTAATCATCAAAACTCACTCACTTGCATTTCTCTCCTAATTTAAGTATTACTCGGTCATACCTTCGCATGCATTTCGCACGCTTCGAAGCAAGATAATCCACTGACCTATCTGTATATG

Full Affymetrix probeset data:

Annotations for 1626845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720