FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626849_at:

>probe:Drosophila_2:1626849_at:465:239; Interrogation_Position=1009; Antisense; AATCAGGGCATGGACTCACTGCGAG
>probe:Drosophila_2:1626849_at:217:439; Interrogation_Position=1031; Antisense; GAGGCACCATATCTCAACTCTATGT
>probe:Drosophila_2:1626849_at:616:681; Interrogation_Position=1051; Antisense; TATGTGAATCCCACTCCATGGATGG
>probe:Drosophila_2:1626849_at:215:105; Interrogation_Position=1088; Antisense; AGACGCAAATGTAGTCCTCTCCGTT
>probe:Drosophila_2:1626849_at:273:679; Interrogation_Position=1099; Antisense; TAGTCCTCTCCGTTCAGATTTAAGA
>probe:Drosophila_2:1626849_at:711:581; Interrogation_Position=1143; Antisense; TGGCGACTCCAAATGTACAGAAATT
>probe:Drosophila_2:1626849_at:411:617; Interrogation_Position=644; Antisense; TGCAGCTGGAGAGCCACATCCAAGA
>probe:Drosophila_2:1626849_at:209:55; Interrogation_Position=676; Antisense; ATGAAGGCCAGCATAGCTCTGCGCA
>probe:Drosophila_2:1626849_at:697:25; Interrogation_Position=688; Antisense; ATAGCTCTGCGCAAGAATCCGTTGG
>probe:Drosophila_2:1626849_at:500:235; Interrogation_Position=703; Antisense; AATCCGTTGGAGTCACTGCGCAAGA
>probe:Drosophila_2:1626849_at:86:211; Interrogation_Position=724; Antisense; AAGAATCCCGTCGTATCGTCCTTAT
>probe:Drosophila_2:1626849_at:361:479; Interrogation_Position=736; Antisense; GTATCGTCCTTATCCGGACTGGGAT
>probe:Drosophila_2:1626849_at:606:133; Interrogation_Position=798; Antisense; ACGCATTCGCAAGGTGTCCAAGGAC
>probe:Drosophila_2:1626849_at:127:379; Interrogation_Position=891; Antisense; GAAGCGACGCGCCATGTTGTCCAAG

Paste this into a BLAST search page for me
AATCAGGGCATGGACTCACTGCGAGGAGGCACCATATCTCAACTCTATGTTATGTGAATCCCACTCCATGGATGGAGACGCAAATGTAGTCCTCTCCGTTTAGTCCTCTCCGTTCAGATTTAAGATGGCGACTCCAAATGTACAGAAATTTGCAGCTGGAGAGCCACATCCAAGAATGAAGGCCAGCATAGCTCTGCGCAATAGCTCTGCGCAAGAATCCGTTGGAATCCGTTGGAGTCACTGCGCAAGAAAGAATCCCGTCGTATCGTCCTTATGTATCGTCCTTATCCGGACTGGGATACGCATTCGCAAGGTGTCCAAGGACGAAGCGACGCGCCATGTTGTCCAAG

Full Affymetrix probeset data:

Annotations for 1626849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720